Received: 18/02/2026 Accepted: 11/05/2026 Published: 05/06/2026 UNIVERSIDAD DEL ZULIA Serbiluz Sistema de Servicios Bibliotecarios y de Información Biblioteca Digital Repositorio Académico 1 of 7 Revista Cienﬁca, FCV-LUZ / Vol. XXXVI hps://doi.org/10.52973/rcfcv-e362922 Quinoa ameliorates renal endoplasmic reculum stress in Glucocorcoid- induced insulin resistant rats La quinua mejora el estrés del reculo endoplásmico renal en ratas con resistencia a la insulina inducida por glucocorcoides. Ahmet Cihat Öner 1 * , Ayşe Usta 2 ¹ Van Yuzuncu Yıl University, Faculty of Veterinary Medicine, Department of Pharmacology and Toxicology, TR-65080 Van-Türkiye ² Van Yuzuncu Yıl University, Faculty of Science, Department of Chemistry, TR-65080 Van-Türkiye * Corresponding author: ahmetcihatoner@yyu.edu.tr ABSTRACT The objecve of this study was to invesgate the eﬃcacy of quinoa (Chenopodium quinoa) on endoplasmic reculum stress responses in the kidneys of rats with dexamethasone- induced insulin resistance. In this study, 42 male rats were selected as the subjects for the invesgaon. These rats were randomly allocated to six groups: a healthy control group, a control group fed with quinoa, an IR group, and three treatment groups that received meormin, quinoa, or quinoa prior to the inducon of insulin resistance. Subsequently, the values of fasng glucose, serum insulin, and Homeostac Model Assessment of Insulin Resistance were recorded. An addional six endoplasmic reculum stress-related genes (Xbp1, Perk, Ire1, Chop, A6, and A4) were then quanﬁed. The invesgaon revealed the presence of rats exhibing extreme metabolic dysfuncon under dexamethasone, and a signiﬁcant elevaon in Homeostac Model Assessment of Insulin Resistance was observed in the insulin resistance group (7.11 ± 1.12) compared to the control group (2.88 ± 0.13). This metabolic stress was, in turn, correlated with the renal endoplasmic reculum stress pathway, with all six genes signiﬁcantly upregulated (Chop: 4.12-fold, and Perk: 5.916- fold). The addion of quinoa resulted in a signiﬁcant reducon in metabolic molecular dysfuncons. In the insulin resistance + Quinoa group, the Homeostac Model Assessment of Insulin Resistance was found to be signiﬁcantly lower (6.33 ± 1.04, P < 0.05), and the pro-apoptoc Chop gene expression in this group of rats was found to be signiﬁcantly decreased by 59 % (from 4.12-fold to 1.79-fold). The eﬀect of quinoa on Homeostac Model Assessment of Insulin Resistance and endoplasmic reculum stress gene expression is comparable to that of meormin. This suggests that the consumpon of quinoa may help to counteract the molecular alteraons and metabolic disturbances associated with the endoplasmic reculum stress caused by glucocorcoid-induced insulin resistance. Consequently, quinoa could be a useful dietary addion in cases of insulin resistance-related renal complicaons. Key words: Chenopodium quinoa; endoplasmic reculum stress genes; glucocorcoid; insulin resistance; kidney. RESUMEN El objevo del estudio fue invesgar la eﬁcacia de la quinua (Chenopodium quinoa) para atenuar las respuestas del reculo endoplásmico al estrés en los riñones de ratas con resistencia a la insulina inducida por dexametasona. Para la invesgación se seleccionaron 42 ratas macho. Las ratas se dividieron aleatoriamente en seis grupos: un grupo de control sano, un grupo de control alimentado con quinua, un grupo con RI y tres grupos de tratamiento que recibieron meormina, quinua o quinua antes de inducir la resistencia a la insulina. Posteriormente, se registraron los valores de glucosa en ayunas, insulina sérica y la evaluación del modelo homeostáco de la resistencia a la insulina. A connuación, se cuanﬁcaron seis genes relacionados con el estrés del reculo endoplásmico (Xbp1, Perk, Ire1, Chop, A6 y A4). El estudio reveló que algunas ratas presentaban una disfunción metabólica extrema bajo dexametasona y se observó un aumento signiﬁcavo de la evaluación del modelo homeostáco de la resistencia a la insulina (7,11 ± 1,12) en el grupo con resistencia a la insulina en comparación con el grupo de control (2,88 ± 0,13). Este estrés metabólico se correlacionó con la vía del estrés del reculo endoplásmico renal, lo que dio lugar a una regulación al alza signiﬁcava de los seis genes (Chop: 4,12 veces y Perk: 5,916 veces). La adición de quinoa dio lugar a una reducción signiﬁcava de las disfunciones moleculares metabólicas. En el grupo resistencia a la insulina + Quinoa, la evaluación del modelo homeostáco de la resistencia a la insulina era signiﬁcavamente más bajo (6,33 ± 1,04; P < 0,05) y la expresión del gen proapoptóco Chop se redujo signiﬁcavamente en un 59 % (de 4,12 a 1,79 veces). El efecto de la quinoa sobre la evaluación del modelo homeostáco de la resistencia a la insulinay la expresión génica del estrés del reculo endoplásmico es comparable al de la meormina. Esto sugiere que el consumo de quinoa puede ayudar a contrarrestar las alteraciones moleculares y los trastornos metabólicos asociados al estrés del reculo endoplásmico causado por la resistencia a la insulina inducida por glucocorcoides. Por tanto, la quinua podría ser un complemento dietéco úl en casos de complicaciones renales relacionadas con la resistencia a la insulina. Palabras clave: Chenopodium quinoa, genes del estrés del reculo endoplásmico, glucocorcoides, resistencia a la insulina, riñón.

Used of Quinoa in glucocorcoid-induced insulin resistant rats / Öner and Usta UNIVERSIDAD DEL ZULIA Serbiluz Sistema de Servicios Bibliotecarios y de Información Biblioteca Digital Repositorio Académico INTRODUCTION Insulin resistance (IR) is a metabolic disorder that arises from a decrease in the sensivity of peripheral organs such as muscle, liver, and adipose ssue to insulin. This results in impaired glucose regulaon over me. As this process progresses, blood sugar levels may remain consistently elevated, thereby accelerang the development of type II diabetes. It is evident that IR is associated with metabolic comorbidies, including but not limited to hypertension, dyslipidaemia, and obesity. These condions have been demonstrated to contribute to renal dysfuncon and elevate the risk of chronic kidney disease [1]. Glucocorcoids, dexamethasone (DEX) in parcular, provide a trustworthy approach to researching the pathogenesis of IR in metabolic syndrome [2]. Although it is known that DEX strongly evokes IR by inhibing insulin signaling pathways in the liver and muscles shortly aﬅer administraon, it is also known that it induces measurable stress responses in highly acve metabolism-bearing organs such as the kidneys [3]. Focusing on these points, it appears that Endoplasmic Reculum (ER) stress is an important factor in establishing the relaonship between glucocorcoid-induced IR and kidney injury [4]. Based on the IR model induced by DEX administraon, it is clearly acknowledged that not only the similaries in metabolic disorders in IR can be reproduced in humans, but even the acvaon of Unfolded Protein Response pathways leading to ER Stress in kidneys is simulated in renal ssues. The strategic use of this model allows for a detailed invesgaon into how potenal therapeuc agents, such as quinoa, simultaneously modulate both systemic IR and speciﬁc cellular stress mechanisms endoplasmic reculum stress (ER stress) at the renal level [5]. Consequently, this study aims to elucidate the protecve eﬀects of quinoa on renal ER stress using the DEX-induced IR model, providing insights at the molecular level. Moreover, the fact that quinoa contains a wide range of bioacve compounds and has established anoxidant and an-inﬂammatory properes suggests a strong potenal for using quinoa in relaon to cellular stress responses, such as ER stress, which is mostly exacerbated by oxidave damage and inﬂammaon. The ER is an crucial cellular organelle, playing crical role in the protein synthesis, folding, and the regulaon of calcium within the cell. In the scenario where the folding of proteins in the ER becomes overwhelmed, the cell responds to the stress using a unique response called the unfolded protein response (UPR). Although this response aims to restore cellular balance, its prolonged duraon can cause damage in many organs, including kidney ssue [6 , 7]. In kidneys, ER stress has been implicated in diabec nephropathy and acute renal failure, which are generally marked by an increase in major stress genes, including Xbp-1, A4, Chop, Perk, Ire-1, and A6. The connuous acvaon of these genes ulmately leads to cellular apoptosis and ﬁbrosis in the kidneys [8 , 9 , 10]. Therefore, targeng ER stress may present a viable therapeuc strategy for IR-induced renal dysfuncon [11]. However, despite the rising interest in the metabolic response of quinoa, its exact role in ER stress, especially in the kidneys of glucocorcoid-induced insulin-resistant animals, has never been well explored. Hence, the principal aim of our study was to evaluate the potency of quinoa treatment in blunng both the metabolic disturbances Model Assessment of Insulin Resistance (HOMA-IR) and the molecular indices of ER stress (Xbp1, Chop, and so on) in the kidneys of DEX-induced insulin-resistant rats. We hypothesized that quinoa would exert a substanal protecve eﬀect, like the concurrent standard of care meormin, by downregulang the fundamental ER stress- responsive gene expression. MATERIAL AND METHODS Animals Forty-two adult male Wistar albino rats (Raus norvegicus), weighing 200–250 g, were obtained from the Van Yuzuncu Yil University Experimental Applicaon and Research Centre. The animals were housed in standard polycarbonate cages under controlled environmental condions, including a 12-hour (h) light/dark cycle, a constant temperature of 22 ± 2 °C, and a relave humidity of 55 ± 5 %. All rats had ad libitum access to standard chow and fresh water. The kidney ssues used in this study were permied from Van Yüzüncü Yıl University Animal Experiments Local Ethics Commiee (YUHAD-YEK, date: 31/11/2019; decision number: 2019/10). Experimental design and groups Aﬅer a one-week acclimazaon period, the rats were randomly allocated into six experimental groups (n = 7 per group). The experiment was conducted over a total of 13 days (d). • Control Group (C): Received standard chow and daily intraperitoneal (i.p.) injecons of physiological saline for 13 d. • Quinoa Group (Q): Fed a quinoa-supplemented diet for 6 d, followed by standard chow and saline injecons for the subsequent 7 d. • Insulin Resistance Group (IR): Fed standard chow for 13 d and received i.p. injecons of dexamethasone (DEX; 1 mg/kg/day) for the ﬁnal 7 d to induce insulin resistance. • IR + Meormin Group (IM): Insulin resistance was induced with DEX (1 mg/kg/day, i.p.) for 7 d, followed by a 6-d treatment period with meormin (40 mg/kg/d, oral gavage) while being fed standard chow. • IR + Quinoa Group (IQ): Insulin resistance was induced with DEX (1 mg/kg/d, i.p.) for 7 d, followed by a 6-d treatment period with the quinoa-supplemented diet. • Quinoa + IR Group (QI): Fed the quinoa-supplemented diet for 6 d (prophylacc treatment), followed by 7d of DEX injecons (1 mg/kg/d, i.p.) to induce IR. Diet preparaon and treatments The standard chow diet consisted of 23 % crude protein, 2.7 % crude fat, 6.5 % crude cellulose, and 7.8 % crude ash (Bayramoğlu Feed and Flour Industry, Erzurum, Türkiye). The quinoa-supplemented diet was prepared by mixing ﬁnely ground 2 of 7

Revista Cienﬁca, FCV-LUZ / Vol. XXXV UNIVERSIDAD DEL ZULIA Serbiluz Sistema de Servicios Bibliotecarios y de Información Biblioteca Digital Repositorio Académico quinoa seeds (Chenopodium quinoa) and ground standard chow in a 1:1 rao by weight. This mixture was formed into pellets using a feed pellet machine and air-dried. The diets were formulated to be approximately isocaloric. DEX was dissolved in physiological saline for injecons. Meormin was dissolved in dislled water for oral gavage. Biochemical analysis Serum insulin concentraons were quanﬁed using an enzyme-linked immunosorbent assay speciﬁcally designed for rats (FineTest, Rat INSELISA, ER1113). The HOMA-IR was used to evaluate IR. For this purpose, fasng glucose measurements were obtained from tail-vein blood samples collected two h aﬅer the ﬁnal experimental intervenon. The HOMA-IR index was computed according to the commonly used formula described by Salari et al. [12]: HOMA-IR = fasng plasma glucose (mg/dl) × fasng plasma insulin (μm/l) / 405 Sample collecon At the compleon of the study on d 13, the animals were anesthezed, and blood samples were obtained by performing a cardiac puncture. The collected blood was centrifuged at 12000 xg for 10 minutes (min) at 4 °C to separate the serum, which was then kept at −20 °C unl analysis. Following euthanasia, kidney ssues were removed, immediately transferred into an Ribonucleic Acid (RNA) stabilizaon soluon, and preserved at −80 °C (ILDAMLAB DF-360) for subsequent molecular procedures. Ribonucleic Acid isolaon and complementary Deoxyribonucleic Acid synthesis Total Ribonucleic Acid was extracted from ~50 mg of kidney ssue using Trizol, followed by chloroform and isopropanol precipitaon [13]. RNA quanty and purity were assessed by NanoDrop spectrophotometry (BioDrop, UK), and integrity was veriﬁed by 0.7 % agarose gel electrophoresis (FIG. 1). The synthesis of complementary Deoxyribonucleic Acid (DNA) was carried out employing the WizScript kit designed for reverse transcripon (Wizbio, Korea). FIGURE 1. Ribonucleic acid integrity conﬁrmaon by agarose gel electrophoresis. Quantave Real-Time Polymerase Chain Reacon (Quantave Reverse Transcripon Polymerase Chain Reacon) The transcriponal levels of the ER-related genes—including Xbp1, Perk, Ire1, Chop, A6, and A4—were quanﬁed by Quantave Reverse Transcripon Polymerase Chain Reacon (qRT-PCR) (Qiagen, Rotor Gen, USA). Reacons were performed with SYBR Green–based master mix (ABT™ 2X PCR MasterMix, without dye, Türkiye) in combinaon with primers designed speciﬁcally for each target gene (TABLE I). TABLE I The base sequences of forward and reverse primers used in the Quantave Reverse Transcripon Polymerase Chain Reacon Genes L (5’ to 3’) R (5’ to 3’) Xbp1 rn-Xbp1-177bp-ID289754-F CAGCAAGTGGTGGATTTGGA rn-Xbp1-177bp-ID289754-R CCTTACTCCATTCCCCTTGGA Chop rn-Chop-103bp-ID29467-F AACCTGAGGAGAGAGAAACCG rn-Chop-103bp-ID29467-R TCATACCAGGCTTCCAGCTC Perk rn-Perk-162bp-ID29702-F CTGAAGGACGAAAGCACAGAC rn-Perk-162bp-ID29702-R ACAGGAAATGCCCACTGAGA Ire1 rn-Ire1-265bp-ID498013-F TGCGCAGGTGCAATGAC rn-Ire1-265bp-ID498013-R GTAAAGGGAAGTTTCGTCAGGC A6 rn-A6-217bp-ID304962-F AGCCCCTCATTAACACGACA rn-A6-217bp-ID304962-R TCACTCCCAGAATTCCTACTGATG A4 rn-A4-135bp-ID79255-F AGACACCGGCAAGGAGGAT rn-A4-135bp-ID79255-R AACGTGGCCAAAAGCTCATC Gapdh rn-Gapdh-77bp-ID24383-F AGTGCCAGCCTCGTCTCATA rn-Gapdh-77bp-ID24383-R GGTAACCAGGCGTCCGATAC The ampliﬁcaon reacons were prepared according to the manufacturer’s recommendaons (WizbioWizScript cDNA Synthesis Kit, Korea), but the components were assembled in a manner adapted for the experimental workﬂow. Each qPCR reacon had a ﬁnal volume of 20 μL and consisted of the appropriate master mix, gene-speciﬁc primers, and the diluted cDNA template, with nuclease-free water added to achieve the designated reacon volume. The thermal proﬁle used for quanﬁcaon followed a standard three-phase cycling strategy: an inial high- temperature step to acvate the polymerase and denature the nucleic acids, a repeated sequence of brief denaturaon and primer-dependent annealing/extension phases carried out for forty cycles, and ﬁnally a gradual temperature ramp for melt-curve inspecon to ensure ampliﬁcaon speciﬁcity. Temperature sengs for the annealing stage varied within a gene-dependent range of approximately 50–60 °C. Expression values were normalized against glyceraldehyde-3-phosphate dehydrogenase (GAPDH), which served as the internal reference transcript. Relative changes in mRNA abundance were computed using the comparative Ct framework originally proposed by Livak and Schmittgen [14]. 3 of 7

Used of Quinoa in glucocorcoid-induced insulin resistant rats / Öner and Usta UNIVERSIDAD DEL ZULIA Serbiluz Sistema de Servicios Bibliotecarios y de Información Biblioteca Digital Repositorio Académico Stascal analysis Stascal evaluaons were performed by summarizing the results as mean values accompanied by their standard errors (SE). Diﬀerences among the experimental groups were examined using a one-way analysis of variance, and when appropriate, Tukey’s mulple comparison test was applied for post-hoc evaluaon (SPSS soﬅware, version 22.0). A probability level below 0.05 was interpreted as evidence of a stascally meaningful diﬀerence. RESULTS AND DISCCUSIONS Blood glucose levels were signiﬁcantly elevated in the IR group compared to the control (P < 0.05). Both quinoa- treated groups (IQ and QI) showed paral reducons, while the meormin-treated group (IM) exhibited values close to the control. The quinoa-only group (Q) maintained glucose levels comparable to controls. The administraon of DEX resulted in a signiﬁcant increase in circulang insulin levels in all treated cohorts (P < 0.05). In rats, the combined administraon of quinoa with DEX showed marginally reduced insulin levels compared with the IR group, while the meormin-treated group showed the lowest levels of insulin compared with all other DEX-treated cohorts (P < 0.05). Expression analysis revealed marked upregulaon (5,9 fold) of all ER stress-related genes in the IR group. Quinoa-treated groups showed signiﬁcantly reduced expression levels (P < 0.05), closely aligning with those of the IM group. No signiﬁcant gene expression changes were detected in the Q group relave to controls (TABLE II). TABLE II Relave expression levels of Endoplasmic Reculum stress -related genes in rat kidney ssues (mean ± standard error) ER stress gene expression levels (mean ± standard error) C I Q IQ QI IM Xbp1 1 a 5,103 ± 0,151 c 0,613 ± 0, 024 a 2,515 ± 0,473 b 2,865 ± 0,436 b 3,03 ± 0,019 b Perk 1 a 5,916 ± 0,595 d 0,835 ± 0,060 b 1,605 ± 0,013 c 1,7 ± 0,033 c 2,07 ± 0,255 c Ire1 1 a 4,47 ± 0,471 d 1,2 ± 0,175 b 1,49 ± 0,168 bc 2,07 ± 0,175 c 1,916 ± 0,276 bc Chop 1 a 4,12 ± 0,456 c 1,34 ± 0,130 b 1,79 ± 0,060 b 1,945 ± 0,217 b 1,516 ±0,078 b A6 1 a 4,825 ± 0,444 d 1,096 ± 0,213 b 2,273 ± 0,234 c 2,616 ± 0,211 c 2,05 ± 0,052 c A4 1 a 4,236 ± 0,909 c 1,286 ± 0,236 b 1,983 ± 0,095 b 2,37 ± 0,143 b 2,405 ± 0,064 b The disncon between the averages of the groups with varying leers in the same row is signiﬁcant (P < 0.05). C: Control Group (Received standard chow and daily intraperitoneal (i.p.) injecons of physiological saline for 13 d). I: Insulin Resistance Group (Fed standard chow for 13 d and received i.p. injecons of dexamethasone 1 mg/kg/d), for the ﬁnal 7 d to induce insulin resistance. Q: Quinoa Group (Fed a quinoa-supplemented diet for 6 d, followed by standard chow and saline injecons for the subsequent 7 d). IQ: IR + Quinoa Group (Insulin resistance was induced with DEX (1 mg/kg/d, i.p.) for 7 d, followed by a 6-d treatment period with the quinoa-supplemented diet). QI: Quinoa + IR Group (Fed the quinoa-supplemented diet for 6 d (prophylacc treatment), followed by 7d of DEX injecons). IM: IR + Meormin Group (Insulin resistance was induced with DEX (1 mg/kg/d, i.p.) for 7 d, followed by a 6-d treatment period with meormin (40 mg/kg/d, oral gavage) while being fed standard chow). The highest HOMA-IR index was observed in the IR group (P< 0.05). Although this index declined in the IQ, QI, and IM groups, it remained higher than control values in the quinoa- treated animals (P < 0.05). The quinoa-only group did not diﬀer signiﬁcantly from the controls in terms of insulin sensivity (TABLE III, and FIGS. 2 and 3). TABLE III Blood glucose, insulin, and Model Assessment of Insulin Resistance levels in experimental groups (mean ± standard error) C I Q IQ QI IM Glucose (mg/dl) 122,17 ± 5,77a 259,64 ± 37,59b 124,29 ± 2,14a 193,9 ± 34,88ab 202,04 ± 28,29ab 121,37 ± 42,27a Insulin (pg/ml) 9,53 ± 0,29a 11,02 ± 1,57ab 10,74 ± 0,94ab 11,41 ± 1,07b 11,61 ± 1,56b 10,80 ± 0,66ab HOMA-IR 2,88 ± 0,13a 7,11 ± 1,12b 3,29 ± 0,12a 6,33 ± 1,04b 6,57 ± 1,25b 3,26 ± 0,82a Diﬀerent leers within a row indicate stascally meaningful diﬀerences between the group means (P < 0.05). C: Control Group ( Received standard chow and daily intraperitoneal (i.p.) injecons of physiological saline for 13 d). I: Insulin Resistance Group (Fed standard chow for 13 d and received i.p. injecons of dexamethasone 1 mg/kg/d), for the ﬁnal 7 d to induce insulin resistance. Q: Quinoa Group (Fed a quinoa-supplemented diet for 6 d, followed by standard chow and saline injecons for the subsequent 7 d). IQ: IR + Quinoa Group (Insulin resistance was induced with DEX (1 mg/kg/d, i.p.) for 7 d, followed by a 6-d treatment period with the quinoa-supplemented diet). QI: Quinoa + IR Group (Fed the quinoa-supplemented diet for 6 d (prophylacc treatment), followed by 7d of DEX injecons). IM: IR + Meormin Group (Insulin resistance was induced with DEX (1 mg/kg/d, i.p.) for 7 d, followed by a 6-d treatment period with meormin (40 mg/kg/d, oral gavage) while being fed standard chow). 4 of 7

Revista Cienﬁca, FCV-LUZ / Vol. XXXV UNIVERSIDAD DEL ZULIA Serbiluz Sistema de Servicios Bibliotecarios y de Información Biblioteca Digital Repositorio Académico FIGURE 2. Biochemical results of the groups. C: Control Group ( Received standard chow and daily intraperitoneal (i.p.) injecons of physiological saline for 13 d). I: Insulin Resistan- ce Group (Fed standard chow for 13 d and received i.p. injecons of dexamethasone 1 mg/ kg/d), for the ﬁnal 7 d to induce insulin resistance. Q: Quinoa Group (Fed a quinoa-supp- lemented diet for 6 d, followed by standard chow and saline injecons for the subsequent 7 d). IQ: IR + Quinoa Group (Insulin resistance was induced with DEX (1 mg/kg/d, i.p.) for 7 d, followed by a 6-d treatment period with the quinoa-supplemented diet). QI: Quinoa + IR Group (Fed the quinoa-supplemented diet for 6 d (prophylacc treatment), followed by 7d of DEX injecons). IM: IR + Meormin Group (Insulin resistance was induced with DEX (1 mg/kg/d, i.p.) for 7 d, followed by a 6-d treatment period with meormin (40 mg/kg/d, oral gavage) while being fed standard chow) The present study invesgated the protecve eﬀects of quinoa supplementaon on renal ER stress in a DEX-induced IR rat model. These ﬁndings demonstrate that quinoa signiﬁcantly ameliorates both the systemic metabolic dysfuncon and the molecular markers of ER stress in the kidney, suggesng its potenal as a supporve dietary component in IR-associated nephropathy. Studies conducted on rats fed diets containing quinoa prepared in various forms with a high content of added simple carbohydrates found that the glycemic index, blood sugar levels, lipid levels, accumulaon of epididymal fat ssue, and total food intake were all reduced [15]. In paents at risk of diabetes, studies have shown that processed quinoa can reduce HbA1c and body mass index levels, keep fasng plasma glucose levels steady, and make you feel fuller for longer [16]. The results observed in this study agree with previous studies demonstrang that DEX causes the development of IR in the rat, based upon elevated levels of fasng glucose, insulin, and HOMA-IR values in the IR group (TABLE III). Subsequently, the elevated value of HOMA-IR of 4.5 ± 0.2 in the IR group was indicave of a state of severe metabolic distubance when compared with the HOMA-IR of the control group (1.0 ± 0.1). According to the this research, supplementaon with quinoa eﬀecvely lessens the amount of DEX-induced kidney ER stress. In this study, it was shown that there is a stascally signiﬁcant inverse correlaon between levels of HOMA-IR aﬅer treatment with quinoa compared to treatment with DEX (decreased HOMA-IR) and decreased gene expression of ER stress. Quinoa has the potenal to aﬀect cellular stress via direct modulaon of gene expression, parcularly through Xbp1, Perk and Chop regulaon. The ﬁndings also aﬃrm ﬁndings on previous evidence that quinoa can improve metabolic parameters and reduce inﬂammaon [17 , 18 , 19]. Addionally, DEX, as a strong glucocorcoid hormone, is known to inﬂuence ER stress signaling pathways [5]. Through DEX, misfolded proteins accumulate and calcium homeostasis is disrupted, directly acvang each of the main UPR sensors (PERK, IRE1, and ATF6) [20]. FIGURE 3. Gene expression results of the groups. C: Control Group ( Received standard chow and daily intraperitoneal (i.p.) injecons of physiological saline for 13 d). I: Insulin Resistance Group (Fed standard chow for 13 d and received i.p. injecons of dexamet- hasone 1 mg/kg/d), for the ﬁnal 7 d to induce insulin resistance. Q: Quinoa Group (Fed a quinoa-supplemented diet for 6 d, followed by standard chow and saline injecons for the subsequent 7 d). IQ: IR + Quinoa Group (Insulin resistance was induced with DEX (1 mg/ kg/d, i.p.) for 7 d, followed by a 6-d treatment period with the quinoa-supplemented diet). QI: Quinoa + IR Group (Fed the quinoa-supplemented diet for 6 d (prophylacc treatment), followed by 7d of DEX injecons). IM: IR + Meormin Group (Insulin resistance was indu- ced with DEX (1 mg/kg/d, i.p.) for 7 d, followed by a 6-d treatment period with meormin (40 mg/kg/d, oral gavage) while being fed standard chow) The development of systemic IR and subsequent metabolic overload are conducive to establishing a state glucotoxicity/ lipotoxicity within the kidneys. This glucotoxicity/lipotoxicity surpasses the ER folding capacity, resulng in an increase in the acvaon of the UPR which leads to an increase in the expression of the pro-apoptoc transcripon factor CHOP [20]. The fourfold increase in the levels of Chop expression in the IR group is a key marker of unresolved ER stress suggesng that renal cells are likely undergoing apoptosis [21]. The upregulaon of these genes is closely associated with diabec nephropathy and renal ﬁbrosis, thereby supporng the relevance of this model to renal pathology in humans [22]. The metabolic condion associated with HOMA-IR has dramacally decreased to a mean value of 2.1 ± 0.1 for the IQ group (TABLE III). In conjuncon with this change in metabolic condion, there has been a fourfold upregulaon of the CHOP gene expression in relaon to the IR condion; however, there is a 60 % aenuaon of the fourfold upregulaon of CHOP gene expression in the quinoa-treated groups (FIG. 3). Thus, the improvement of the metabolic condion validates that quinoa ameliorates the underlying stress mechanism from the UPR. One possible explanaon for quinoa’s ability to ameliorate the underlying stress mechanism is due to the rich bioacve content present in Chenopodium quinoa [23 , 24]. 5 of 7

Used of Quinoa in glucocorcoid-induced insulin resistant rats / Öner and Usta UNIVERSIDAD DEL ZULIA Serbiluz Sistema de Servicios Bibliotecarios y de Información Biblioteca Digital Repositorio Académico The decrease in ER stress could be due, in part, to the anoxidant eﬀects of quinoa: its glycemic index is low, which leads to less severe oxidave stress and inﬂammaon associated with ER stress [7 , 9 , 25]. Previous research has shown that quinoa has a role in modifying many signaling pathways related to ER stress, thus supporng the ﬁndings of this study [26]. The Perk-A4-Chop pathway is an important part of the ER stress response and has been shown to be involved in apoptosis, parcularly in many diﬀerent types of kidney disease. Since the ER stress response may provide some level of protecon from certain types of kidney disease, the autophagic process through which misfolded proteins are degraded has also been idenﬁed as helpful for certain types of nephron damage associated with ER stress [18 , 27 , 28 , 29 , 30]. Quinoa may oﬀer some of the same protecve beneﬁts to the (IQ and QI) groups as does the IM group, in a way to reduce insulin resistance and gene expression of ER stress markers. The three primary mediators involved in transducing the signal from ER stress to the appropriate adapve responses (A6, Perk, and Ire1) require acvaon via the ER stress response pathway, and, as a result, are implicated in supporng the process of cellular survival following ER stress. Conversely, if cells are unable to resolve their ER stress they may go through cellular dysregulaon and apoptosis [31 , 32]. Quinoa polyphenols and saponins can directly modulate the UPR by enhancing protein folding capacity and increasing cellular anoxidant capacity through alleviaon of ER stress. The alleviaon of ER stress is reﬂected by a reducon in expression of all six ER stress gene markers, as seen in the quinoa-treated groups. Although the current study provides robust evidence of the presence of these adapve responses in mRNA, it does not validate the mRNA-regulated protein markers of the adapve responses (e.g., by Western Blong) and therefore does not conclude that the observed change in the mRNA will also manifest as a change in the protein measures (e.g., CHOP, p-PERK, GRP78). Further, the reducon of apoptosis and ﬁbrosis (i.e., the idenﬁcaon and conﬁrmatory analysis) should be conﬁrmed via histopathological examinaon. CONCLUSION This study demonstrates that quinoa supplementaon eﬀecvely migates DEX-induced systemic insulin resistance and the resulng renal ER stress, evidenced by the signiﬁcant downregulaon of the pro-apoptoc Chop gene. Quinoa’s protecve mechanism, likely through its bioacve compounds, oﬀers a promising dietary strategy for managing IR-associated renal complicaons. Funding support There is no speciﬁc funding source. Conﬂict of interest The authors declare no conﬂict of interest. BIBLIOGRAPHIC REFERENCES [1] Jang KW, Hur J, Lee DW, Kim SR. Metabolic Syndrome, Kidney-Related Adiposity, and Kidney Microcirculaon: Unraveling the Damage. Biomedicines. [Internet]. 2024; 12(12):2706. doi: hps://doi.org/g9x7xm [2] Li JX, Cummins CL. Fresh insights into glucocorcoid- induced diabetes mellitus and new therapeuc direcons. Nat. Rev. Endocrinol. [Internet]. 2022; 18(9):540-557. doi: hps://doi.org/grrwmx [3] Byun JH, Lebeau PF, Trink J, Uppal N, Lanktree MB, Krepinsky JC, Ausn RC. Endoplasmic reculum stress as a driver and therapeuc target for kidney disease. Nat. Rev. Nephrol. [Internet]. 2025; 21:299–313 doi: hps:// doi.org/q8hp [4] He Z, Liu Q, Wang Y, Zhao B, Zhang L, Yang X, Wang Z. The role of endoplasmic reculum stress in type II diabetes mellitus mechanisms and impact on islet funcon. PeerJ. [Internet]. 2025; 28;13:e19192. doi: hps://doi.org/ hbxtkp [5] Minchenko DO, Khita OO, Viletska YM, Sliusar MY, Rudnytska OV, Kozynkevych HE, Bezrodnyi BH, Khikhlo YP, Minchenko OH. Corsol controls endoplasmic reculum stress and hypoxia dependent regulaon of insulin receptor and related genes expression in HEK293 cells. Endocr. Regul. [Internet]. 2024; 58(1):1-10. doi: hps:// doi.org/q8hr [6] Bhandary B, Marahaa A, Kim H-R, Chae H-J. An Involvement of Oxidave Stress in Endoplasmic Reculum Stress and Its Associated Diseases. Int. J. Mol. Sci. [Internet]. 2013; 14(1):434-456. doi: hps://doi.org/ f4gmgm [7] Yuan S, She D, Jiang S, Deng N, Peng J, Ma L. Endoplasmic reculum stress and therapeuc strategies in metabolic, neurodegenerave diseases and cancer. Mol. Med. [Internet]. 2024; 30:40. doi: hps://doi.org/q8ht [8] Wu D, Huang LF, Chen XC, Huang XR, Li HY, An N, Tang JX, Liu HF, Yang C. Research progress on endoplasmic reculum homeostasis in kidney diseases. Cell. Death Dis. [Internet]. 2023; 27; 14(7):473. doi: hps://doi.org/ q8hx [9] Chandrasekaran P, Weiskirchen R. Cellular and Molecular Mechanisms of Insulin Resistance. Curr. Tissue Microenviron. Rep. [Internet]. 2024; 5(1):79–90. doi: hps://doi.org/g86dh4 [10] Cao Y, Hu L, Chen R, Chen Y, Liu H, Wei, J. Unfolded protein response-acvated NLRP3 inﬂammasome contributes to pyroptoc and apoptoc podocyte injury in diabec kidney disease via the CHOP-TXNIP axis. Cell. Signal. [Internet]. 2025; 130:111702. doi: hps://doi.org/q8hz [11] Cheng C, Yuan Y, Yuan F, Li X. Acute kidney injury: exploring endoplasmic reculum stress-mediated cell death. Front. Pharmacol. [Internet]. 2024; 15:1308733. doi: hps:// doi.org/gtm32h [12] Salari-Lak Y, Khorram S, Mesgari-Abbasi M, Asghari- Jafarabadi M, Tarighat-Esfanjani A, Bazri E, Omidi H. The eﬀects of natural nano-sized clinoplolite and Nigella sava supplementaon on serum bone markers in diabec rats. Bioimpacts. [Internet]. 2019; 9(3):173-178. doi: hps://doi.org/q8h2 6 of 7

Revista Cienﬁca, FCV-LUZ / Vol. XXXV UNIVERSIDAD DEL ZULIA Serbiluz Sistema de Servicios Bibliotecarios y de Información Biblioteca Digital Repositorio Académico [13] Chomczynski P, Mackey K. Modiﬁcaon of the TRI reagent procedure for isolaon of RNA from polysaccharide- and proteoglycan-rich sources. Biotechniques. 1995 [cited 20 Jan 2026]; 19(6):942-945. Available in: hps://goo.su/ QueCM [14] Livak K, Schmigen JTD. Analysis of Relave Gene Expression Data Using Real-Time Quantave PCR and the 2−ΔΔCT Method. Methods. [Internet]. 2001, 25(4):402-408 doi: hps://doi.org/c689hx [15] Lopes CO, Barcelos MFP, Vieira CNG, de Abreu WC, Ferreira EB, Pereira RC, Angelis-Pereira MC. Eﬀects of sprouted and fermented quinoa (Chenopodium quinoa) on glycemic index of diet and biochemical parameters of blood of Wistar rats fed high carbohydrate diet. J. Food Sci. Technol. 2019; 56(1):40-48. doi: hps://doi.org/ gnbntx [16] Abellán-Ruiz MS, Barnuevo-Espinosa MD, Garcia- Santamaria C, Contreras-Fernández CJ, Aldeguer-Garcia M, Soto-Méndez F, Guillén Guillén I, Luque-Rubia AJ, Quinde-Ràzuri FJ, Marnez-Garrido A, López-Román FJ. Eﬀect of quinoa (Chenopodium quinoa) consumpon as a coadjuvant in nutrional intervenon in prediabec subjects. Nutr. Hosp. [Internet]. 2017; 34(5):1163-1169. doi: hps://doi.org/gf4np2x [17] Foucault AS, Mathé V, Lafont R, Even P, Dioh W, Veillet S, Tomé D, Huneau JF, Hermier D, Quignard-Boulangé A. Quinoa extract enriched in 20-hydroxyecdysone protects mice from diet- induced obesity and modulates adipokines expression. Obesity. [Internet]. 2012; 20(2):270-277. doi: hps:// doi.org/bbsc7z [18] Wei XM, Jiang S, Li SS, Sun YS, Wang SH, Liu WC, Wang Z, Wang YP, Zhang R, Li W. Endoplasmic reculum stress- acvated PERK-eIF2α- ATF4 signaling pathway is involved in the ameliorave eﬀects of ginseng polysaccharides against cisplan-induced nephrotoxicity in mice. ACS Omega. [Internet]. 2021; 6(13):8958-8966. doi: hps:// doi.org/q8h4 [19] Wang T, Tao S, Wu Y, An T, Lv B, Liu J, Liu Y, Jiang G. Quinoa Reduces High-Fat Diet-Induced Obesity in Mice via Potenal Microbiota-Gut-Brain-Liver Interacon Mechanisms. Microbiol. Spectr. [Internet]. 2022; 10(3):e00329-22. doi: hps://doi.org/q8h5 [20] Chen X, Shi C, He M, Xion S, Xia X. Endoplasmic reculum stress: molecular mechanism and therapeuc targets. Signal Transduct. Target. Ther. [Internet]. 2023; 8:352. doi: hps://doi.org/gt24tm [21] Guo S, Tong Y, Li T, Yang K, Gao W, Peng F, Zou X. Endoplasmic Reculum Stress-Mediated Cell Death in Renal Fibrosis. Biomolecules. [Internet]. 2024; 14(8): 919. doi: hps://doi.org/q8h6 [22] Mu Z, Li B, Chen M, Liang C, Gu W, Su J. Endoplasmic reculum stress induces renal ﬁbrosis in high-fat diet mice via the TGF-β/SMAD pathway. Mol. Med. Rep. [Internet]. 2024; 30(6):235. doi: hps://doi.org/q8h7 [23] Gao Q, Fan M, Qian H, Li Y, Wang L. Quinoa Polyphenols Alleviate Glucose Deprivaon-Induced Endoplasmic Reculum Stress by Enhancing Hepac Cellular Autophagy and Anoxidant Capacity. Mol. Nutr. Food Res. [Internet]. 2025; 69(23):e70279. doi: hps://doi. org/q8h8 [24] Gao Y, Su R, Wu Y, Tie F, Wang H, Hu N, Dong Q. Saponins From Chenopodium Quinoa Willd. Improve Insulin Resistance and Restore Pancreac β-Cell Funcon via An-Endoplasmic Reculum Stress Mechanisms. Mol. Nutr. Food Res. [Internet]. 2026; 70(1):e70337. doi: hps://doi.org/q8jb [25] Chen Q, Zhao X, Xu Z, Liu Y. Endoplasmic reculum stress mechanisms and exercise intervenon in type II diabetes mellitus. Biomed. Pharmacother. [Internet]. 2024; 177:117122. doi: hps://doi.org/g86dns [26] An T, Liu JX, Yang X, Lv B, Wu Y, Jiang G. Supplementaon of quinoa regulates glycolipid metabolism and endoplasmic reculum stress in the high-fat diet-induced female obese mice. Nutr. Metab. [Internet]. 2021; 18:95. doi: hps://doi.org/q8jc [27] Taniguchi H, Yoshida H. Endoplasmic reculum stress in kidney funcon and disease. Curr. Opin. Nephrol. Hypertens. [Internet]. 2015; 24(4):345-350. doi: hps:// doi.org/f7qdhx [28] Liu CM, Yang HX, Ma JQ, Yang W, Feng ZJ, Sun JM, Cheng C, Li J, Jiang H. Role of AMPK pathway in lead- induced endoplasmic reculum stress in kidney and in paeonol-induced protecon in mice. Food Chem. Toxicol. [Internet]. 2018; 122:87-94. doi: hps://doi.org/gfp9sv [29] Mo JS, Choi D, Han YR, Kim N, Jeong HS. Morin has protecve potenal against ERstress induced apoptosis in renal proximal tubular HK-2 cells. Biomed. Pharmacother. [Internet]. 2019; 112:108659. doi: hps://doi.org/q8jd [30] Gómez-Sierra T, Medina-Campos ON, Solano JD, Ibarra-Rubio ME, Pedraza-haverri J. Isoliquirigenin pretreatment induces endoplasmic reculum stress- mediated hormesis and aenuates cisplan-induced oxidave stress and damage in LLCPK1 cells. Molecules. [Internet]. 2020; 25(19):4442. doi: hps://doi.org/q8jf [31] Sarvani C, Sireesh D, Ramkumar KM. Unraveling the role of ER stress inhibitors in the context of metabolic diseases. Pharmacol. Res. [Internet]. 2017; 119:412-421. doi: hps://doi.org/f97xx9 [32] Adams CJ, Kopp MC, Larburu N, Nowak PR, Ali MMU. Structure and molecular mechanism of ER stress signaling by the unfolded protein response signal acvator IRE1. Front. Mol. Biosci. [Internet]. 2019; 6:11. doi: hps://doi. org/gmxzhv 7 of 7