Revista Cienfica, FCV-LUZ / Vol. XXXV Recibido: 12/12/2025 Aceptado: 10/02/2026 Publicado: 12/03/2026 UNIVERSIDAD DEL ZULIA Serbiluz Sistema de Servicios Bibliotecarios y de Información Biblioteca Digital Repositorio Académico 1 of 11 Revista Cienfica, FCV-LUZ / Vol. XXXVI UNIVERSIDAD DEL ZULIA Serbiluz Sistema de Servicios Bibliotecarios y de Información Biblioteca Digital Repositorio Académico Effect of Ozonized saline soluon on oxidave stress in cats with Feline Infecous Peritonis Efecto de la solución salina ozonizada sobre el estrés oxidavo en gatos con peritonis infecciosa felina Rahşan Koc Akpinar 1* , Büşra Şahin 2 , Medine Özlek 3 , Sercan Sever 3 , Yücel Meral 3 , Duygu Dalgin 3 , Sena Çenesiz 2 ¹Republic of Türkiye, Ministry of Agriculture and Forestry, Samsun Veterinary Control Instute, 55200, Samsun, Türkiye. ²Ondokuz Mayıs University, Faculty of Veterınary, Department of Biochemistry, 55100, Samsun, Türkiye. ³Ondokuz Mayıs University, Faculty of Veterınary, Department of İnternal Medicine, 55100, Samsun, Türkiye. *Corresponding Author: rahsankoc23@hotmail.com ABSTRACT Feline infecous peritonis is a viral disease in cats characterized by systemic involvement and a frequently fatal outcome. Diagnosis is established through a comprehensive assessment of clinical signs and laboratory findings. The aim of this study was to evaluate the efficacy of a single intravenous administraon of 100 mL of 0.9 % isotonic sodium chloride soluon, ozonated at a concentraon of 5 μg/mL for 5 minutes using the Vetozone Medical Ozone Device, on oxidave stress parameters and survival me. In this context, oxidave stress markers were compared before and aſter treatment to provide scienfic data on the potenal therapeuc effects of ozonated saline in veterinary medicine. The study was conducted on a sample of 10 domesc cats diagnosed with Feline infecous peritonis, all of which were monitored for a follow-up period of 6 months to assess clinical progression and survival. In the study conducted on cats diagnosed with Feline infecous peritonis, administraon of ozonated saline resulted in increased total anoxidant capacity and nave thiol levels, accompanied by decreases in total oxidant capacity, oxidave stress index, and disulfide levels at the 1-hour mark. Although these changes were not stascally significant (P > 0.05), the findings suggest that ozone exerts a regulatory effect on oxidave stress and helps restore the thiol–disulfide balance toward an anoxidant state. In addion, the treatment markedly improved clinical signs, reduced oxidave stress markers, and achieved a 100 % survival rate in the treated cats. These results indicate that ozonated saline soluon, by reducing free radical–induced cellular damage in cats with Feline infecous peritonis, has the potenal to be used as a supporve (adjuvant) approach rather than as a directly curave therapeuc agent. Nevertheless, larger controlled clinical studies with extended follow-up periods are required to validate these effects and to standardize the therapeuc protocol. Key words: Cat; Feline infecous peritonis; oxidave stress; ozone; reverse transcripon-polymerase chain reacon; Türkiye. RESUMEN La peritonis infecciosa felina es una enfermedad viral caracterizada por afectación sistémica y un pronósco frecuentemente fatal. El diagnósco se establece mediante una evaluación exhausva de los signos clínicos y de los hallazgos laboratoriales. El objevo de este estudio fue invesgar la eficacia de una única administración intravenosa de 100 mL de solución de cloruro de sodio al 0,9 %, ozonificada a 5 μg/mL durante 5 minutos mediante el disposivo Vetozone Medical Ozone, sobre los parámetros de estrés oxidavo y el empo de supervivencia. Para este fin, se compararon los marcadores de estrés oxidavo antes y después del tratamiento, con el propósito de aportar datos cienficos sobre el valor terapéuco de la solución salina ozonificada en medicina veterinaria. El estudio incluyó 10 gatos doméscos diagnoscados con peritonis infecciosa felina, seguidos clínicamente durante seis meses para evaluar la evolución y supervivencia. Tras la administración de solución salina ozonificada, se observó un incremento en los niveles de capacidad anoxidante total y de ol navo, acompañado por reducciones en capacidad oxidante total, índice de estrés oxidativo y disulfuro a la hora posterior al tratamiento. Aunque dichas variaciones no alcanzaron significación estadísca (P > 0,05), los resultados sugieren que el ozono podría ejercer un efecto modulador sobre el estrés oxidavo, favoreciendo la restauración del equilibrio ol–disulfuro hacia un estado anoxidante. Además, se evidenció una mejoría notable de los signos clínicos, una disminución de los marcadores de estrés oxidavo y una tasa de supervivencia del 100 % en los animales tratados. Estos resultados indican que la solución salina ozonificada, al reducir el daño celular inducido por radicales libres en gatos con peritonis infecciosa felina, ene el potencial de ulizarse como un enfoque de apoyo (adyuvante) más que como un agente terapéuco directamente curavo. No obstante, se requieren invesgaciones clínicas controladas, con muestras más amplias y períodos de seguimiento prolongados, para confirmar estos efectos y establecer protocolos terapéucos estandarizados. Palabras clave: Gato; peritonis infecciosa felina; estrés oxidavo; ozono; reacción en cadena de la polimerasa con transcripción inversa; Türkiye. https://doi.org/10.52973/rcfcv-e362876

Revista Cienfica, FCV-LUZ / Vol. XXXVI UNIVERSIDAD DEL ZULIA Serbiluz Sistema de Servicios Bibliotecarios y de Información Biblioteca Digital Repositorio Académico INTRODUCTION Feline coronaviruses (FCoV) belong to the Coronaviridae family and are biologically divided into two subtypes: Feline Enteric Coronavirus (FECV) and Feline Infecous Peritonis Virus (FIPV) [1]. FECV is mostly considered a non-pathogenic strain, causing only mild cases of diarrhea [2]. In contrast, Feline Infecous Peritonis (FIP), a pathogenic strain, is a systemic and oſten fatal infecous disease [1 , 3]. The disease can occur in three clinical forms: effusive (wet), noneffusive (dry) and mixed [3 ,4]. The effusive (wet) form of FIP is characterized by fluid accumulaon in body cavies (such as the abdomen, chest or pericardium) and is the most common clinical form. In contrast, the non-effusive (dry) form is characterized by neurological symptoms (e.g. paralysis, seizures, head shaking), systemic symptoms (fever, anorexia, weight loss, malaise, weakness, rarely jaundice) and organ involvement (such as granulomas in the kidneys and lesions in the lungs) [4 ,5]. The lack of a single specific and definive diagnosc test for FIP complicates the diagnosis. Therefore, the diagnosis is supported by a combinaon of clinical symptoms and laboratory methods such as enzyme-linked immunosorbent assay (ELISA), virus neutralizaon tests, molecular analyses [1 , 6 , 7 , 8 , 9 , 10]. Furthermore, hemogram and various biochemical parameters also provide valuable informaon in the differenal diagnosis of FIP [1 , 11]. Different results have been reported in hematologic and biochemical studies in cats (Felis catus) with FIP [1 , 12]. The most commonly reported hematologic findings in FIP cases include mild anemia, lymphopenia and thrombocytopenia. It has been reported that approximately 65 % of cats with FIP develop anemia. In paents with FIP, hematocrit values usually fall below 30 % and decreased hemoglobin levels can be observed [6 , 9 , 12 , 13 , 14]. In biochemical analysis, one of the most common laboratory findings in cats with FIP is hyperglobulinemia, which is observed in approximately 40-60 % of cases [6 , 12 , 13 , 15]. The increase in total protein levels is due to an increase in plasma anbody concentraon, mainly in the gamma-globulin fracon, and a decrease in albumin levels [9]. Not only increased globulin levels but also decreased albumin levels are typical in cats with FIP [6 , 14 , 16]. Liver failure or increased vascular permeability can lead to low albumin and consequently a reduced albumin/globulin (A/G) rao. A/G rao below 0.8 is considered a high-risk indicator for FIP, with a diagnosc accuracy of 92 % at this threshold. In contrast, an A/G rao above 0.8 significantly reduces the likelihood of FIP [6 , 12 , 15]. The FIP virus selecvely infects monocytes and macrophages, the main defense cells of the immune system, and acvely replicates in these cells [1]. The replicaon of the virus in these cells triggers excessive release of cytokines, leading to an intense and uncontrolled immune response. In this process, especially through proinflammatory cytokines, the producon of reacve oxygen species (ROS) increases and oxidave stress develops as a result [17]. Oxidave stress causes damage to cell structures, contribung to disrupon of physiological balance, damage to the interacon between the immune system and ssue, and worsening of the course of the disease [17 , 18]. In this context, ozone therapy has been invesgated since the late 20th century due to its posive effects on redox balance. Ozone is defined as a powerful oxidant that triggers the producon of ROS when it comes into contact with biological fluids. These molecules accelerate ssue regeneraon by smulang cellular metabolism and also show anbacterial and anviral effects [19 , 20 , 21]. The anviral effect of ozone is associated with oxidave damage to phospholipid and glycoprotein structures in the virus membrane, disrupon of viral integrity and inhibion of replicaon [22 , 23]. However, ozone cannot directly inacvate intracellular pathogens; instead, it indirectly smulates the immune system, producing a protecve effect through neutrophil acvaon and cytokine release [24 , 25]. In clinical applicaons, ozone is successfully used as supporve therapy, especially in cases of resistant infecons, slow-healing lesions and poor epithelializaon. Examples include diabec ulcers, feline immunodeficiency virus (FIV) infecons and chronic wound healing in horses (Eqqus caballus) [26 , 27]. It is known that oxidave stress plays an important role in the pathogenesis of FIP and anoxidant defense systems are insufficient in this process. This situaon facilitates the progression of the disease and aggravates the clinical picture. In this context, ozonated saline soluon with its immune-modulang (immunomodulatory) and oxidave damage-reducing (anoxidant) effects draws aenon as an alternave supporve treatment opon in addion to tradional therapies [26]. This study was planned to invesgate the effects of ozonated saline applicaon on oxidave stress levels in cats diagnosed with FIP. MATERIALS AND METHODS Ethical statement This study was conducted with permission from the Local Ethics Commiee for Animal Experiments of the Samsun Veterinary Control Instute, under the leer dated 22.11.2024 with reference number 19572899/031-90. (Decision no: 2024/08). Collecon of samples This study included 10 domesc cats presented to Pa Veterinary Clinic in Samsun in 2024 with a preliminary diagnosis of FIP, confirmed by clinical and laboratory evaluaons. In accordance with internaonal ethical standards and the 3R (Replace, Reduce, Refine) principles, no control group was established. The creaon of a placebo or untreated control group was considered ethically inappropriate due to the high mortality rate and progressive nature of FIP, as withholding a potenally beneficial intervenon could compromise animal 2 of 11

Effect of Ozonized saline soluon on oxidave stress in cats / Akpinar et al. UNIVERSIDAD DEL ZULIA Serbiluz Sistema de Servicios Bibliotecarios y de Información Biblioteca Digital Repositorio Académico welfare. Therefore, the study design priorized both scienfic validity and ethical responsibility, enabling the collecon of preliminary data regarding the potenal therapeuc effects of a single intravenous administraon of ozonated saline soluon. Observed clinical signs included lethargy, anorexia, weight loss, respiratory distress, ocular lesions, high fever, fluid accumulaon, and neurological symptoms. In cases with a preliminary diagnosis of FIP, demographic and clinical data, including sex, breed, age, disease form (effusive/ non-effusive), and response to treatment, were collected and are presented in TABLE I. Clinical findings observed in FIP-suspected cats included lethargy, anorexia, weight loss, respiratory distress, ocular lesions, high fever, fluid accumulaon in the thoracic and abdominal cavies, and neurological symptoms. TABLE I Distribuon of Breed, Age, Gender, Clinical Form and Response to Treatment in Cats with Feline Infecous Peritonis Admied to the Veterinary Clinic Paent Number Race Age (Month) Gender Form of the Disease Response to treatment 1 Brish Shorthair 8 Female Efusiv Form Alive 2 Tabby 5.5 Female Non-Effusive Form Alive 3 Scosh Fold 1.5 Male Efusiv Form Alive 4 Tabby 5 Male Non-Effusive Form Alive 5 Tabby 10.5 Female Non-Effusive Form Alive 6 Brish Shorthair 10 Female Efusiv Form Alive 7 Tabby 10 Female Non-Effusive Form Alive 8 Tabby 15 Male Non-Effusive Form Alive 9 Tabby 13 Male Efusiv Form Alive 10 Tabby 8 Female Efusiv Form Alive The study material consisted of cats diagnosed with FIP based on clinical signs, Nested RT-PCR, hematological and serum biochemical analyses, and ultrasonographic examinaon. Blood samples were collected from the antebrachial cephalic vein; 4 mL samples were used for biochemical analyses and 1 mL for hematological analyses. Whole blood was analyzed shortly aſter collecon using an automac hematology analyzer, and biochemical tests were performed the same day with an automac biochemistry analyzer. Samples were centrifuged (Nüve, CN 180, Türkiye) at 1000 g for 15 minutes (min) to obtain serum, which was stored in a deep freezer (Arçelik, 2041 Nd, Türkiye) -20 °C for oxidative stress analysis. Serum samples were collected at treatment initiation, 1 hour (h) post-treatment, and 2 days (d) post-treatment. Ultrasounde examinaon Radiographic evaluaon (DR TECH, EXPRIMER, South Korea) revealed pleural effusion in the thoracic cavity and free fluid accumulaon in the abdominal region. This widespread effusion paern is considered a typical finding consistent with systemic diseases, parcularly the effusive (wet) form of FIP (FIG. 1A). Abdominal ultrasonography (CHISON EBIT 60, China) revealed a hyperechoic line in the renal medulla, known as the ‘renal medullary rim sign’ (FIG. 1B). This ultrasonographic finding has been reported in some infecous and inflammatory processes, parcularly FIP, and is considered a non-specific but noteworthy sign. Rivalta test A sterile tube containing 100 mL of dislled water and 1 drop of 98 % acec acid was mixed homogeneously, and one drop of effusion fluid was carefully added to the prepared soluon. The effusion drop remaining suspended in the soluon without dispersing was considered a posive result (FIG 2C). This finding is an important diagnosc criterion in the characterisaon of effusion and serves as a clinically meaningful indicator for disnguishing between transudate and exudate in pleural and/ or peritoneal fluids associated with inflammatory or infecous aeology. In the effusive (wet) form of FIP, the presence of exudate-type fluids with high protein content and a viscous character is characterisc. Therefore, a posive test result can be considered a supporve finding for the possibility of FIP. A B C D FIGURE. 1. Ultrasound image and Rivalta test in Cats with FIP. (A) Effusion image on thoracoabdominal radiography. (B) Renal medullary rim sign image. (C) Posive Rivalta test (All images have been obtained from cases included in this study). (D) Nested RT-PCR gel images of Feline Infecous Peritonis. 3 of 11

Revista Cienfica, FCV-LUZ / Vol. XXXVI UNIVERSIDAD DEL ZULIA Serbiluz Sistema de Servicios Bibliotecarios y de Información Biblioteca Digital Repositorio Académico Hematologic analyzes In hematological analyses, total leukocyte (WBC) count, granulocyte (GRA), monocyte (MID), lymphocyte (LYM) counts and percentages, platelet (PLT) and erythrocyte (RBC) counts were measured from blood samples containing K3EDTA. In addion, hemoglobin (Hb) concentraon, hematocrit (Hct), mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH) and mean corpuscular hemoglobin concentraon (MCHC) were also determined in blood samples with a blood analyzer (Mindray BC60R Vet HI-END Laser & Fluorescent Hemogram Device, China). Biochemical analyses In biochemical analyses, total protein (TP), albumin (A), blood urea nitrogen (BUN), creanine levels and alanine aminotransferase (ALT), lactate dehydrogenase (LDH) and alkaline phosphatase (ALP) acvies were measured by photometric method. These analyses were performed using a biochemistry device (RX Monoco Fully Automated bbo Architect Ci8200 Biochemistry device, USA). In addion, globulin (G) levels were determined by subtracng albumin value from total protein value for each cat and A/G raos were calculated using these values. In the evaluaon of oxidave stress; total anoxidant capacity (TAS) (Rel Assay), total oxidant capacity (TOS) (Rel Assay), nave thiol (Rel Assay) and total thiol (Rel Assay) parameters were measured using calorimetric test kits according to the procedure recommended in the kit. The measurements of the kits used were performed on an ELISA plate reader device. The oxidave stress index (OSI) was calculated based on the obtained TAS and TOS values. Since OSI is calculated as the rao of TOS to TAS, it is expressed without a physical dimension. The rao of TOS to TAS: Disulfide (SS) levels were calculated using nave thiol and total thiol measurements. Accordingly, half of the difference between total thiol and nave thiol concentraons was recorded as the SS level. These parameters were used to evaluate thiol– disulfide homeostasis. The principle of the total oxidant capacity colorimetric test kit is based on the formaon of a colored complex between iron ion and chromogen in acidic medium. The intensity of the color formed can vary depending on the number of oxidants in the sample. The intensity of this color change is determined spectrophotometrically. The principle of the Total Anoxidant colorimetric test kit is based on measuring the absorbance of the color change in the dark blue-green ABTS of anoxidants in biological material. The OSI value is calculated aſter the TAS and TOS data are determined. The principle of total thiol test kits is that reducible SS bonds are reduced to form free funconal thiol groups. The unused reductant sodium borohydride is consumed and removed with formaldehyde and reduced aſter reacon with 5,5’-dithiobis-(2- nitrobenzoic) acid (DTNB) and all thiol groups including natural thiol groups are determined. Half of the difference between total thiols and nave thiols is recorded as the dynamic SS amount. Aſter determinaon of natural thiols (SH) and total thiols, SS amounts were calculated. Molecular analysis Viral RNA was extracted from plasma samples using the Roche High Pure Viral Nucleic Acid Kit (REF:11858874001, Germany), reverse-transcribed to cDNA with the QIAGEN cDNA Synthesis Kit (01188772, Vilnius, Lithuania), and detected by nested PCR using Thermo Scienfic DreamTaq (EP0702, Lot 0124949). The primer sets used were: P205/ P211 (223 bp): P205: GGCAACCCGATGTTTAAAACTGG, P211: CACTAGATCCAGACGTTAGCTC; P276/P204 (177 bp): P276: CCGAGGAATTACTGGTCATCGCG, P204: GCTCTTCCATTGTTGGCTCCTCGTC. PCR products were subsequently analyzed by gel electrophoresis [28]. Treatment protocol During the treatment process, cat owners were provided with both verbal and wrien informaon about the ozone therapy that would be administered to their pets in addion to the treatment; informed consent was obtained prior to the applicaon. Because accepted supporve treatment protocols are available for FIP, the deliberate withholding of treatment from diagnosed cats was considered ethically inappropriate. Therefore, an untreated control group was not established in this study. All cases received standard convenonal therapy, and addionally, ozonated saline soluon was administered as a supporve treatment. The treatment protocol administered to paents includes a complementary ozone therapy applicaon in addion to tradional pharmacological approaches. Within the scope of convenonal treatment, prednisolone, known for its an-inflammatory and immunomodulatory effects, was administered orally (PO) once daily at an inial dose of 2 mg/kg. The dose was reduced to 1 mg/kg in the second week and to 0.5 mg/kg in the third week, with the treatment disconnued at the end of the third week. Addionally, pentoxifylline, preferred for its microcirculatory-enhancing and anoxidant properes, was administered orally once daily at a dose of 10 mg/kg in non- effusive cases and up to 25 mg/kg in effusive cases depending on the clinical condion, and the treatment was maintained for 4 weeks. In addion to this treatment, Ozone therapy was applied as a supporve method. For this purpose, 100 mL of 0.9 % isotonic sodium chloride soluon was ozonated at a concentraon of 5 μg/mL for 5 min using the Vetozone Medical Ozone Device. Since the first 48 hours of the disease are considered crical in cats with FIP, the ozonated soluon was administered as a single intravenous (IV) dose following diagnosis. The aim was to ulise the potenal an-inflammatory, immunomodulatory and cellular oxygenaon-enhancing effects of ozone therapy. This protocol was designed to evaluate the synergisc effects of both convenonal and complementary medical approaches. Stascal analysis All stascal calculaons of the data were performed using SPSS stascs 27 program. Shapiro-Wilk test was used to evaluate whether the data were normally distributed. For the comparison of repeated measures, repeated measures test was applied to the normally distributed data. Friedman test, which is a nonparametric test, was applied to the non-normally distributed data. Data with a P value less than 0.05 were considered significant. 4 of 11

Effect of Ozonized saline soluon on oxidave stress in cats / Akpinar et al. UNIVERSIDAD DEL ZULIA Serbiluz Sistema de Servicios Bibliotecarios y de Información Biblioteca Digital Repositorio Académico RESULTS AND DISCUSSION Complete blood count (Hemogram) As a result of the haematological analyses conducted in the study, mild increases in total leukocyte count, neutrophil count, and monocyte count were observed in cats diagnosed with FIP. This finding was interpreted as an indicator of the inflammatory response associated with the disease. Addionally, total erythrocyte counts and haemoglobin levels were found to be near the lower limit of the reference range, while HCT values were significantly reduced below 30 %. This haematological profile indicates the presence of anaemia in cats with FIP, alongside leukocytosis caused by neutrophils and monocytes. Hemogram findings of the cats with FIP in this study are given in TABLE II. TABLE II Analysis of Hematologic Parameters of Cats Diagnosed with Feline Infecous Peritonis Parameters Value ± (Mean SD) Unite WBC 14.848 ± 6.553 (×10⁹/L) Neu 11.098 ± 4.486 (×10⁹/L) LYM 2.061 ± 1.947 (×10⁹/L) Mon 0.660 ± 0.378 (×10⁹/L) Eos 1.416 ± 1.428 (×10⁹/L) Bas 0.060 ± 0.071 (×10⁹/L) Neu % 0.769 ± 0.133 (%) Lym % 0.135 ± 0.101 (%) Mon % 0.044 ± 0.025 (%) Eos % 0.088 ± 0.060 (%) Bas % 0.004 ± 0.005 (×10⁹/L) PLT 304.000 ± 104.001 (×10⁹/L) MPV 13.020 ± 1.619 (fL) PDW 14.010 ± 0.436 (fL) PCT 3.944 ± 1.435 (%) IPF 21.150 ± 12.072 (%) RBC 7.314 ± 1.522 (×10¹²/L) HGB 9.790 ± 1.739 (g/dL) HCT 27.660± 5.239 (%) MCV 38.250 ± 5.244 (fL) MVH 13.520 ± 1.558 (pg) MCHC 354.800 ± 19.521 (g/dL) RDW-CV 0.200 ± 0.030 (%) RDW-SD 27.000 ± 5.259 (fL) RET 25.130 ± 13.165 (×10⁹/L) RET% 0.350 ± 0.180 (%) IRF 8.870 ± 6.501 (%) LFR 91.130 ± 6.501 (%) MFR 8.690 ± 6.472 (%) HFR 0.770 ± 0.359 (%) RHE 16.380 ± 1.141 (pg) WBC: White Blood Cell count, Neu: Neutrophil count, LYM: Lymphocyte count, Mon: Monocyte count, Eos: Eosinophil count, Bas: Basophil count, Neu %: Neutrophil percentage, Lym %: Lymphocyte percentage, Mon %: Monocyte percentage, Eos %: Eosinophil percentage, Bas %: Basophil percentage, PLT: Platelet count, MPV: Mean Platelet Volume, PDW: Platelet Distri- buon Width, PCT: Plateletcrit, IPF: Immature Platelet Fracon, RBC: Red Blood Cell count, HGB: Hemoglobin, HCT: Hematocrit, MCV: Mean Corpuscular Volume, MVH: Mean Hemoglobin Volume, MCHC: Mean Corpuscular Hemoglobin Concentraon, RDW-CV: Red Cell Distribuon Width–Coefficient of Variaon, RDW-SD: Red Cell Distribuon Width–Standard Deviaon, RET: Reculocyte count, RET%: Reculocyte percentage, IRF: Immature Reculocyte Fracon, LFR: Low Fluorescence Rao, MFR: Medium Fluorescence Rao, HFR: High Fluorescence Rao, RHE: Reculocyte Hemoglobin Equivalent 5 of 11

Revista Cienfica, FCV-LUZ / Vol. XXXVI UNIVERSIDAD DEL ZULIA Serbiluz Sistema de Servicios Bibliotecarios y de Información Biblioteca Digital Repositorio Académico Although various hematologic and laboratory abnormalies have been reported in cats diagnosed with FIP, none of these parameters are pathognomonic [1 , 9 , 29 , 30 , 31 , 32]. In a retrospecve study by Riemer et al. [33], lymphopenia was found in approximately 49.5 % of paents with FIP, neutrophilia with leſt shiſt in 39-57 %, and mild to moderate normocyc normochromic anemia in 37-54 %. Similarly, in this current study, neutrophilia and anemia were found in cats diagnosed with FIP. These hematologic changes are thought to be a reflecon of the physiologic stress on the hemopoiec system associated with the chronic nature of the disease and endogenous stress responses that occur during infecon. In the literature, it has been reported that hematocrit levels in FIP paents are frequently below 30 %; the mean hematocrit value of 27.66 % obtained in the study supports these findings [6 , 9 , 13 , 14]. These data contribute to a beer understanding of the hematologic profile of FIP. Biochemical analysis Biochemical analysis results of the cats with FIP included in the study are given in TABLE III. Biochemistry analyses performed in the study revealed an increase in total protein level, suggesng that this may be associated with hyperglobulinemia specific to FIP. Albumin level (2.67 ± 0.59 g/dL) was close to the lower limit of the reference range and this is associated with decreased liver synthesis and fluid losses during inflammaon. G levels significantly above the reference range (3.4-5.2 g/dL) are indicave of a characterisc outcome for FIP. While an ALB/Glob rao of < 0.4 supports the diagnosis, this rao was found to be 0.39 ± 0.11 in the study. Total bilirubin level (1.48 ± 2.15 mg/dL) was found to be above the reference range (0-0.4 mg/dL); this increase is associated with liver damage, hemolysis or bile flow disorders. Biochemical analyses of cats with FIP show that the disease causes characterisc changes in certain parameters. Among these changes, significant increases in total bilirubin, total protein and globulin levels and significant decreases in albumin levels and A/G rao [32 , 34]. TABLE III Analysis of Biochemical Parameters of Cats Diagnosed with Feline Infecous Peritonis Parameters Values ± (Mean SD) Urea (mg/dL) 37.02 ± 18.66 Creanine (mg/dL) 0.83 ± 0.48 Total Protein (g/dL) 9.79 ± 1.89 Albumin (g/dL) 2.67 ± 0.59 Total Bilurubin (mg/dL) 1.48 ± 2.15 Direct Bilirubin (mg/dL) 0.25 ± 0.53 ALT (IU/L) 57.60 ± 51.84 AST (IU/L) 47.04 ± 37.50 ALP (IU/L) 22.00 ± 10.79 Phosphorus (mg/dL) 4.79 ± 1.12 Globulin (g/dL) 7.12 ± 1.80 A/G % 0.39 ± 0.11 ALT: Alanine Aminotransferase, AST: Aspartate Aminotransferase, ALP: Alkaline Phosphata- se, A/G: albumin/globulin rao. Studies have revealed that A/G rao may be an important biochemical indicator in the diagnosis of FIP. Especially in cases where the A/G rao is > 0.8, the probability of FIP is considered low, while a decrease in this rao to < 0.4 indicates a high risk for FIP [9 , 31 , 35]. Hartmann et al. [15] reported that the probability of FIP increased in cats with an A/G rao < 0.45, while the disease was largely excluded when the rao was > 0.8.10 The mean A/G rao of 0.39 ± 0.11 obtained in this study was consistent with the results of Norris et al. [13] and Tsai et al. [11] in the literature and supported that this rao may be a valuable biomarker in the diagnosis of FIP. In the study, TAS, TOS, OSI, nave thiol, total thiol and SS values were determined as important biomarkers in the evaluaon of the oxidant/anoxidant balance of the organism. The results are given in TABLE IV and FIG. 2. TABLE IV Parameters 0. h 1. h 2. day P value TAS (mmolTroloxEq/L) 0.74 ± 0.22 0.87 ± 0.38 0.74 ± 0.28 0.569 TOS (μmol H 2 O 2 Eq/L) 46.62 ± 23.85 29.83 ± 16.06 49.36 ± 17.33 0.118 OSI (AU) 64.57 ± 27.87 42.10 ± 27.77 74.94 ± 29.72 0.074 Nave thiol (μmoL/L) 160.86 ± 90.51 103.65 ± 61.67 112.09 ± 76.33 0.123 Total thiol (μmoL/L) 427.23 ± 251.45 331.65 ± 233.72 485.19 ± 326.31 0.233 Disulfide (μmoL/L) 133.18 ± 95.02 114.00 ± 120.63 340.28 ± 248.35 0.407 Changes in Total anoxidant capacity, Total oxidant capacity, oxidave stress index, Nave thiol, Total thiol and Disulfide serum values according to hours in ozone treated animals (X ± SD). TAS (Total anoxidant capacity), TOS (Total oxidant capacity), OSI (Oxidave stress index), 0.h (before treatment), 1. h (1 hour aſter treatment), 2. d ( 2 day aſter treatment) Total anoxidant capacity (TAS), Total oxidant capacity (TOS), Oxidave stress index (OSI), nave thiol, total thiol and disulfide levels were analyzed in three me periods: before treatment (0th h), 1 h aſter the start of treatment and on the 2nd d in order to evaluate the effect of ozonized saline soluon on oxidave stress parameters in cats diagnosed with FIP. In this study results, no stascally significant difference was found between the groups in terms of TAS, TOS, OSI, nave thiol, total thiol and disulfide values (P > 0.05). 6 of 11

Effect of Ozonized saline soluon on oxidave stress in cats / Akpinar et al. UNIVERSIDAD DEL ZULIA Serbiluz Sistema de Servicios Bibliotecarios y de Información Biblioteca Digital Repositorio Académico However, TAS levels increased while TOS, OSI and SS levels decreased in the 1st h, although it was not stascally significant. TOS level increased due to the natural course of the infecon. However, ozone administraon prevented excessive increase in TOS levels in the first h aſter treatment. This suggests that ozone may have a regulatory effect on oxidave stress when used in a controlled manner. The study results show that ozonized saline applicaon increased anoxidant acvity and decreased oxidave stress in the 1st h. In addion, an increase in nave thiol levels (P > 0.05) and a decrease in SS levels (P > 0.05) were observed, although not stascally significant, with the strengthening of the anoxidant defense system at 1 h aſter ozone administraon. This shows that the thiol-disulfide balance is restructured in the anoxidant direcon and ozone provides a protecve effect in this process. Oxidave stress has been associated with many viral infecons in both humans and animals and is usually caused by the acon of proinflammatory cytokines released early in the infecon. Cats are more suscepble to the development of oxidave stress due to their unique metabolic characteriscs. This is due to the limited capacity of their anoxidant system and the role of oxidave stress in the pathogenesis of feline pathogenesis has become an important research topic. However, studies evaluang the effects of anoxidant supplements in cats are quite limited [17 , 18 , 36]. Webb et al. [37] reported that oxidave stress is prominent in cats infected with FIV, which leads to loss of CD4 (+) T lymphocytes. Similarly, other studies in cats with FIV have emphasized the potenal therapeuc benefits of anoxidant supplements; however, more controlled studies are needed in this area [38]. To date, there has been no direct study on the role of oxidave stress in the physiopathology of FIP [38 , 39 , 40]. In this respect, the present study is one of the studies aiming to evaluate oxidave stress in cats diagnosed with FIP. In the study, a stascally significant negave correlaon was found between TAS and TOS; this finding coincides with the study of Suresh et al. [41] who previously reported low TAS levels in cats with FIV. Similarly, low TAS levels were also observed in this study. However, a significant increase in TAS levels and a decrease in TOS, OSI and SS levels were recorded in the first hour following administraon of ozonated saline soluon. These results suggest that ozone treatment may modulate oxidave stress by acvang the anoxidant defense system in the short term. However, due to the chronic and progressive course of FIP, a decrease in TAS levels was observed again from d two. This suggests that the anoxidant capacity of the body becomes insufficient with the progression of the disease and the oxidave load increases again. An increase in TOS levels was observed due to the natural process of the infecon. However, ozone treatment suppressed the sharp rise in TOS in the first h aſter treatment and showed a regulatory effect in the acute phase of oxidave stress. These findings suggest that controlled ozone administraon may be a potenal supporve therapy that may stabilize the oxidave stress response in viral diseases such as FIP. However, it should not be ignored that this effect may be limited in the long term due to the nature of chronic infecons. FIGURE 2. Serum TAS (Total anoxidant capacity), TOS (Total oxidant capacity), OSI (Oxidave stress index), Nave Thiol, Total Thiol and Disulfide Levels. Nested RT-PCR The products obtained by PCR were run using 1.5 % agarose gel electrophoresis and visualized under UV light. The gel was evaluated together with posive and negave controls and the result was considered posive if a band was formed at 177 bp. In the negave control group, no band is expected [28]. The gel image showing the PCR results is presented in FIG.1D. In recent years, RT-PCR, one of the molecular methods in the diagnosis of FIP, has become an important tool, especially due to its sensivity for the detecon of viral RNA. However, due to the genec similaries between enteric coronavirus (FECV) and the mutated form causing FIP (FIPV), the use of RT-PCR alone as a differenal diagnosc tool remains limited [9 , 28]. Therefore, RT-PCR results should be evaluated together with clinical findings and hematologic/ biochemical parameters. In this study, the diagnosis of FIP was confirmed by RT-PCR and the results were interpreted in an integrated manner with other laboratory findings. Changes in clinical findings aſter treatment Significant improvements were observed in the clinical evaluaons of treated paents. In parcular, increased appete 7 of 11

Revista Cienfica, FCV-LUZ / Vol. XXXVI UNIVERSIDAD DEL ZULIA Serbiluz Sistema de Servicios Bibliotecarios y de Información Biblioteca Digital Repositorio Académico and normalizaon of mild fever were among the notable findings. A marked increase in the acvity levels of paents was detected, and improvement in the color of the mucosal membranes indicated an enhancement in the systemic condion. In addion, notable reducons in effusion-related symptoms were observed; abdominal distension improved significantly, and remarkable improvement in respiratory distress was achieved. These findings were considered strong indicators of a posive clinical response to treatment. A significant decrease in clinical symptoms was recorded post-treatment, with a 100 % survival rate maintained within the first 48 h of treatment and throughout the subsequent six-month follow-up period. The six-month survival data were obtained from the clinical records of all treated cats and informaon provided by their owners. Each cat was monitored aſter treatment at predefined intervals (1 week, 1 month, 3 months, and 6 months) through regular clinical examinaons and direct communicaon with the owners. During these follow-ups, clinical findings, general health status, and survival were systemacally recorded. Throughout the follow-up period, a connuous and consistent improvement in the general health status of the cats was observed, with a marked increase in their quality of life. Although the sample size was limited, these longitudinal observaons reliably demonstrate that all cats survived during the six-month period following ozone therapy. In conclusion, the applied treatment protocol significantly improved the overall health status and quality of life of the paents. Nevertheless, despite the favorable clinical outcomes obtained, the treatment of FIP remains complex, prolonged, and economically demanding. Therefore, early diagnosis and the implementaon of appropriate supporve treatment strategies are of paramount importance to enhance the sustainability of clinical improvement and to maximize therapeuc success [1 , 9 , 42 , 43]. In this context, the present study evaluated the potenal contribuon of ozonized saline soluon, administered in addion to convenonal therapy, to oxidave stress parameters and overall treatment efficacy. Feline infecous peritonis is a common disease worldwide, reported in North America (USA and Canada), Africa (South Africa and Senegal), Asia (Japan), Oceania (Australia) and several countries in Europe (United Kingdom, Ireland, Netherlands, Germany, Belgium, Switzerland and France) [29]. FIP has long been regarded as a disease with a poor prognosis, characterized by a progressive and oſten fatal course. Today, FIP remains a serious health problem in cats due to the difficulty of treatment and the inability of current vaccines to provide adequate protecon [44]. However, the development of anviral agents for the treatment of human coronavirus infecons has generated new hope for effecve and life-saving therapeuc opons for FIP. Despite these advances, FIP treatment remains limited in many countries, and in some cases, unlicensed or unregistered anviral drugs are used [45 , 46 , 47]. Remdesivir, which has been widely used in the treatment of COVID-19, has been evaluated in numerous studies for the treatment of FIP in cats [47 , 48]. Coggins et al. [48] reported that 96 % of cats with FIP treated with remdesivir survived throughout a six-month follow-up period, provided they survived the first 48 h of therapy. Similarly, in a randomized study conducted by Anwer et al. [49], the overall survival rate among 16 cats diagnosed with effusive FIP was 87.5 %, while survival reached 100 % among cats that survived the inial 48 h of treatment. In light of these findings, the single-dose ozonated saline administraon, given in addion to the convenonal supporve treatments in our study, may have contributed to the prolonged survival of cats that survived the first 48 hours of therapy and the observed 100% survival rate throughout the follow-up period; this suggests that ozone administraon could be considered a supporve (adjuvant) approach in the management of FIP. According to Roy et al. [45], of 11 cats in which GS-441524 treatment was unsuccessful, 8 achieved remission aſter switching to Molnupiravir [45]. This finding suggests that Molnupiravir may serve as a potenally effecve alternave therapy in FIP cases that do not respond to GS- 441524. Ritz et al. [50] reported a mean survival me of 9 days in FIP-affected cats treated with feline interferon-omega. Similarly, Fischer et al. [51] documented an average survival me of 8 days in cats treated with polyprenyl immunosmulant. Tsai et al. [11] reported a mean survival me of 21.3 ± 19.9 d in cats diagnosed with effusive FIP. Collecvely, these findings indicate that convenonal and supporve treatment protocols are insufficient to substanally alter the fatal course of FIP. Corcosteroids remain widely used in clinical pracce as part of supporve therapy. In the study conducted by Moyadee et al. [12], cats with FIP receiving supporve treatment with prednisolone (Prednol®) exhibited a mean survival me of 38 d. This observaon suggests that prednisolone may contribute to suppression of the inflammatory response and temporary alleviaon of clinical signs; however, it does not represent a curave treatment when used alone. Similar to its role in the management of COVID-19, corcosteroids in FIP appear to funcon primarily as supporve agents rather than definive therapeuc intervenons. The primary therapeuc goal in FIP management is to control the excessive inflammatory response associated with disease progression while supporng the overall health status of the affected cats. In this context, supporve care strategies—including immune support, clinical symptom management, and stress reducon—represent essenal components of the treatment protocol [9 , 30 , 52]. In the present study, the clinical and biochemical effects of ozonated saline soluon as a supporve therapy were evaluated in cats diagnosed with FIP. All paents received convenonal supporve treatment supplemented solely with ozonated saline. Following ozone therapy, increased appete, normalizaon of mild pyrexia, improvement in mucosal coloraon, and a marked enhancement in general clinical condion were observed. The achievement of a 100 % survival rate throughout the follow- up period, together with a marked reducon in clinical signs, suggests that ozonated saline administraon may provide potenal biological benefits as a supporve (adjuvant) approach in cats with FIP rather than exerng a direct curave effect. However, these findings do not constute definive evidence of therapeuc efficacy and should be interpreted as indicang possible favorable biological effects on clinical condion and oxidave stress parameters. Data obtained in this study demonstrated that ozonated saline administraon increased total anoxidant capacity and reduced oxidave stress levels within the first hour of treatment. Furthermore, an increase in nave thiol levels accompanied by a decrease in disulfide levels indicated a strengthening of the 8 of 11

Effect of Ozonized saline soluon on oxidave stress in cats / Akpinar et al. UNIVERSIDAD DEL ZULIA Serbiluz Sistema de Servicios Bibliotecarios y de Información Biblioteca Digital Repositorio Académico anoxidant defense system and a shiſt of the thiol–disulfide balance toward an anoxidant-favorable state. These findings suggest that ozone therapy may exert a protecve role through modulaon of oxidave stress and inflammatory processes. CONCLUSION This study provides pioneering and valuable evidence regarding the clinical and biochemical effects of ozonized saline soluon administered in addion to standard supporve treatments in FIP cases. Following treatment, notable clinical improvements were observed in cats, including increased appete, normalizaon of mild fever, enhanced acvity levels, and improvement in mucosal coloraon. Effusion-related symptoms decreased, and respiratory distress showed significant alleviaon. Moreover, ozonized saline treatment enhanced anoxidant capacity in the short term, reducing oxidave stress and posively modulang the thiol–disulfide balance. However, the chronic and progressive nature of FIP limited the long-term preservaon of these beneficial effects. One of the most notable findings of this study was that all cats receiving ozonated saline in addion to standard supporve therapy survived throughout the six-month follow-up period, as documented by clinical evaluaons conducted at the first, third, and sixth months. Given the aggressive and frequently fatal course of FIP, this finding does not imply a direct curave effect of ozone therapy; rather, it suggests that ozonated saline may confer potenal biological benefits when applied as a supporve (adjuvant) intervenon. However, the present results do not provide conclusive evidence of therapeuc efficacy and should be interpreted as indicang possible supporve effects on clinical status and oxidave stress–related parameters. Accordingly, further well-designed, controlled studies with larger sample sizes and extended follow-up duraons are warranted to confirm these findings, clarify the role of ozone therapy in FIP management, and assess its reliability in clinical pracce. Conflict of Interest The authors declare that they have no conflict of interest. BIBLIOGRAPHIC REFERENCES [1] Pedersen NC. A review of feline infecous peritonis virus infecon: 1963–2008. J. Feline Med. Surg. [Internet]. 2009; 11(4):225–258. doi: hps://doi.org/g9k5 [2] Simons FA, Vennema H, Rofina JE, Pol JM, Horzinek MC, Roer PJ, Egberink HF. A mRNA PCR for the diagnosis of feline infecous peritonis. J. Virol. Methods. [Internet]. 2005; 124(1-2):111-116. doi: hps://doi.org/bspjb4 [3] Tanaka Y, Sato Y, Takahashi D, Matsumoto H, Sasaki T. Treatment of a case of feline infecous peritonis with cyclosporin A. Vet. Rec. Case Rep. [Internet]. 2015; 3(1):e000134. doi: hps://doi.org/qsv2 [4] Kennedy MA. Feline infecous peritonis: update on pathogenesis, diagnoscs, and treatment. Vet. Clin. N. Am. Small Anim. Pract. [Internet]. 2020; 50(5):1001- 1011. doi: hps://doi.org/gn6d4riio [5] Kipar A, Bellmann S, Gunn-Moore DA, Leukert W, Köhler K, Menger S, Reinacher M. Histopathological alteraons of lymphac ssues in cats without feline infecous peritonis aſter long-term exposure to FIP virus. Vet. Microbiol. [Internet]. 1999; 69(1-2):131-137. doi: hps:// doi.org/b2xb [6] Hartmann K. Feline infecous peritonis. Vet. Clin. N. Am. Small Anim. Pract. [Internet]. 2005; 35(1):39-79. doi: hps://doi.org/cn39h4 [7] Dye C, Siddell SG. Genomic RNA sequence of feline coronavirus strain FCoV C1Je. J. Feline Med. Surg. [Internet]. 2007; 9(3):202-213. doi: hps://doi.org/ btswzs [8] Shiba N, Maeda K, Kato H, Mochizuki M, Iwata H. Differenaon of feline coronavirus type I and II infecons by virus neutralizaon test. Vet. Microbiol. [Internet]. 2007; 124(3-4):348-352. doi: hps://doi.org/c9qz4h [9] Addie D, Belák S, Boucraut-Baralon C, Egberink H, Frymus T, Gruffydd-Jones T, Hartmann K, Hosie MJ, Lloret A, Lutz H, Marsilio F, Pennisi MG, Radford AD, Thiry E, Truyen U, Horzinek MC. Feline infecous peritonis. ABCD guidelines on prevenon and management. J. Feline Med. Surg. [Internet]. 2009; 11(7):594-604. doi: hps://doi.org/fsrxcs [10] Thayer V, Gogolski S, Felten S, Hartmann K, Kennedy M, Olah GA. 2022 AAFP/EveryCat feline infecous peritonis diagnosis guidelines. J. Feline Med. Surg. [Internet]. 2022; 24(9):905-933. doi: hps://doi.org/qswn [11] Tsai HY, Chueh LL, Lin CN, Su BL. Clinicopathological findings and disease staging of feline infecous peritonis: 51 cases from 2003 to 2009 in Taiwan. J. Feline Med. Surg. [Internet]. 2011; 13(2):74-80. doi. hps://doi.org/ btp5w4 [12] Moyadee W, Sunpongsri S, Choowongkomon K, Roytrakul S, Raanasrisomporn A, Tansakul N, Raanasrisomporn J. Feline infecous peritonis: A comprehensive evaluaon of clinical manifestaons, laboratory diagnosis, and therapeuc approaches. J. Adv. Vet. Anim. Res. [Internet]. 2024; 11(1):19-26. doi: hps://doi.org/qswp [13] Norris JM, Bosward KL, White JD, Baral RM, Ca MJ, Malik R. Clinicopathological findings associated with feline infecous peritonis in Sydney, Australia: 42 cases (1990–2002). Aust. Vet. J. [Internet]. 2005; 83(11):666- 673. doi: hps://doi.org/d3bqhv [14] Hartmann K, Hein J. Bartonellosis. In:Hartmann K, Hein J, eds. Infekonskrankheiten der Katze. 1st edion. Hannover, Deutschland: Schlütersche Verlagsgesellschaſt mbH & Co KG.: 2008; 182–188. [15] Hartmann K, Binder C, Hirschberger J, Cole D, Reinacher M, Schroo S, Frost J, Egberink H, Lutz H, Hermanns W. Comparison of different tests to diagnose feline infecous peritonis. J. Vet. Intern. Med. [Internet]. 2003; 17(6):781-790. doi: hps://doi.org/bgt55z [16] Marteles D, Lebrero ME, Fernández A, Orn A, González A, Morell C, Villanueva MJ, Schäfer I, Quílez P, Verde M, Gómez A, Villanueva-Saz S. Impact of single versus mulple infecon on serum protein fracons in cats. Vet. Res. Commun. [Internet]. 2025; 49(3):158. doi: hps:// doi.org/qsw5 9 of 11

Revista Cienfica, FCV-LUZ / Vol. XXXVI UNIVERSIDAD DEL ZULIA Serbiluz Sistema de Servicios Bibliotecarios y de Información Biblioteca Digital Repositorio Académico [17] Nohl H, Gille L, Staniek K. Intracellular generaon of reacve oxygen species by mitochondria. Biochem. Pharmacol. [Internet]. 2005; 69(5):719-723. doi: hps:// doi.org/c3fcf5 [18] Decaro N, Martella V, Saif LJ, Buonavoglia C. COVID-19 from veterinary medicine and one health perspecves: What animal coronaviruses have taught us. Res. Vet. Sci. [Internet]. 2020; 131:21-23. doi: hps://doi.org/ggr26w [19] Bocci V. Ozone: A New Medical Drug. 1st ed. Dordrecht: Springer Netherlands; 2005. [20] Kim HS, Noh SU, Han YW, Kim KM, Kang H, Kim HO, Park YM. Therapeuc effects of topical applicaon of ozone on acute cutaneous wound healing. J. Korean Med. Sci. [Internet]. 2009; 24(3):368-374. doi: hps://doi.org/ cn8c8r [21] Travagli V, Zanardi I, Valacchi G, Bocci V. Ozone and ozonated oils in skin diseases: a review. Mediators Inflamm. [Internet]. 2010; 2010(1):610418. doi: hps:// doi.org/d88b4z [22] Rowen RJ, Robins H. Ozone therapy for complex regional pain syndrome: review and case report. Curr. Pain Headache Rep. [Internet]. 2019; 23(6):41. doi: hps:// doi.org/gnxs8v [23] Moreira-Vilar FC, Siqueira-Soares RDC, Finger-Teixeira A, Oliveira DMD, Ferro AP, da Rocha GJ, Ferrarese MLL, dos Santos WD, Ferrarese-Filho O. The acetyl bromide method is faster, simpler and presents best recovery of lignin in different herbaceous ssues than Klason and thioglycolic acid methods. PloS One. [Internet]. 2014; 9(10):e110000. doi: hps://doi.org/gnm9v3 [24] Bocci VA. Scienfic and medical aspects of ozone therapy. State of the art. Arch. Med. Res. [Internet]. 2006; 37(4):425-435. doi: hps://doi.org/bwgfx6 [25] Kawahara R, Freitas PHBD, Rocha, Poblete SS. Ozonioterapia no tratamento da Imunodeficiência Viral Felina (FIV): relato de caso. Nos. Clín. [Internet]. 2019 [cited 22 Oct 2025]; 22(132):12–20. Available in: hps:// goo.su/dpwF4B [26] Elvis AM, Ekta JS. Ozone therapy: A clinical review. J. Nat. Sci. Biol. Med. [Internet]. 2011; 2(1):66-70. doi: hps:// doi.org/b4845m [27] Sciorsci RL, Lillo E, Occhiogrosso L, Rizzo A. Ozone therapy in veterinary medicine: A review. Res. Vet. Sci. [Internet]. 2020; 130:240-246. doi: hps://doi.org/gnqvpw [28] Herrewegh AA, De Groot RJ, Cepica A, Egberink HF, Horzinek MC, Roer PJ. Detecon of feline coronavirus RNA in feces, ssues, and body fluids of naturally infected cats by reverse transcriptase PCR. J. Clin. Microbiol. [Internet]. 1995; 33(3):684-689. doi: hps://doi.org/qsxx [29] Solikhah TI, Agusn QAD, Damaratri RA, Siwi DAF, Rafi’uaqi GN, Hartadi VA, Solikhah GP. A review of feline infecous peritonis virus infecon. Vet. World. [Internet]. 2024; 17(11):2417-2432. doi: hps://doi.org/ qsxz [30] Carlson KJ, Macinre DK. Feline Infecous Peritonis. Emerg. Crit. Care Med. 2006; 18(1):1-11. [31] Aytuğ N. Kedi Enfeksiyonları 1: Zorlayan Tanı; Kedilerin Enfeksiyöz Peritonisi. [Internet]. Uludag Univ. J. Fac. Vet. Med. 2008 [cited 22 oct 2025]; 27(1-2):11-17. Available in: hps://goo.su/DbG7KQ [32] Gao YY, Wang Q, Liang XY, Zhang S, Bao D, Zhao H, Li SB, Wang K, Hu GX, Gao FS. An updated review of feline coronavirus: Mind the two biotypes. Virus Res. 2023; 326:199059. doi: hps://doi.org/grq9dr [33] Riemer F, Kuehner KA, Ritz S, Sauter-Louis C, Hartmann K. Clinical and laboratory features of cats with feline infecous peritonis–a retrospecve study of 231 confirmed cases (2000–2010). J. Feline Med. Surg. [Internet]. 2015; 18(4):348-356. doi: hps://doi.org/ f8g6hh [34] Sparkes AH, Hopper CD, Millard WG, Gruffydd-Jones TJ, Harbour DA. Feline immunodeficiency virus infecon clinicopathologic findings in 90 naturally occurring cases. J. Vet. Intern. Med. [Internet]. 1993; 7(2):85-90. doi: hps://doi.org/dz4w52 [35] Jeffery U, Deitz K, Hosteer S. Posive predicve value of albumin: globulin rao for feline infecous peritonis in a mid-western referral hospital populaon. J. Feline Med. Surg. [Internet]. 2012; 14(12):903-905. doi: hps://doi. org/f4dz55 [36] Erel O, Neselioglu S. A novel and automated assay for thiol/disulphide homeostasis. Clin. Biochem. [Internet]. 2014; 47(18):326-332. doi: hps://doi.org/f6r6dk [37] Webb C, Lehman T, McCord K, Avery P, Dow S. Oxidave stress during acute FIV infecon in cats. Vet. Immunol. Immunopathol. [Internet]. 2008; 122(1-2):16-24. doi: hps://doi.org/b6gcmt [38] Webb C, Bedwell C, Guth A, Avery P, Dow S. Use of flow cytometry and monochlorobimane to quantate intracellular glutathione concentraons in feline leukocytes. Vet. Immunol. Immunopathol. [Internet]. 2006; 112(3-4):129-140. doi: hps://doi.org/frpk5b [39] Treinger A, Spada C, Verdi JC Miranda AF, Oliveira OV, Silveira MV, Moriel P, Abdalla DS. Decreased anoxidant defence in individuals infected by the human immunodeficiency virus. Eur. J. Clin. Invesg. [Internet]. 2000; 30(5):454-459. doi: hps://doi.org/ csqrcf [40] Flohé L. Looking back at the early stages of redox biology. Anoxidants. [Internet]. 2020; 9(12):1254. doi: hps:// doi.org/gnw8km [41] Suresh DR, Annam V, Prabha K, Prasad BM. Total anoxidant capacity–a novel early bio-chemical marker of oxidave stress in HIV infected individuals. J. Biomed. Sci. [Internet]. 2009; 16(1):61. doi: hps://doi.org/ bzfxbb [42] Li C, Liu Q, Kong F, Guo D, Zhai J, Su M, Sun D. Circulaon and genec diversity of Feline coronavirus type I and II from clinically healthy and FIP-suspected cats in China. Transbound. Emerg. Dis. [Internet]. 2019; 66(2):763-775. doi: hps://doi.org/qsx4 [43] Sase O, Iwami T, Sasaki T, Sano T. GS-441524 and molnupiravir are similarly effecve for the treatment of cats with feline infecous peritonis. Front. Vet. Sci. [Internet]. 2024; 11:1422408. doi: hps://doi.org/qsx5 [44] Hu T, Zhang H, Zhang X, Hong X, Zhang T. Prevalence and risk factors associated with feline infecous peritonis (FIP) in Mainland China between 2008 and 2023: A systemac review and meta-analysis. Animals. [Internet]. 2024; 14(8):1220. doi: hps://doi.org/g9h6sn 10 of 11

Effect of Ozonized saline soluon on oxidave stress in cats / Akpinar et al. UNIVERSIDAD DEL ZULIA Serbiluz Sistema de Servicios Bibliotecarios y de Información Biblioteca Digital Repositorio Académico [45] Roy M, Jacque N, Novicoff W, Li E, Negash R, Evans, SJ. Unlicensed Molnupiravir is an Effecve Rescue Treatment Following Failure of Unlicensed GS-441524-like Therapy for Cats with Suspected Feline Infecous Peritonis. Pathogens. [Internet]. 2022; 11(10):1209. doi: hps:// doi.org/qsx7 [46] Negash R, Li E, Jacque N, Novicoff W, Evans SJ. Owner experience and veterinary involvement with unlicensed GS-441524 treatment of feline infecous peritonis: A prospecve cohort study. Front. Vet. Sci. [Internet]. 2024; 11:1377207. doi: hps://doi.org/qsx8 [47] Green J, Syme H, Tayler S. Thirty-two cats with effusive or non-effusive feline infecous peritonis treated with a combinaon of remdesivir and GS-441524. J. Vet. Intern. Med. [Internet]. 2023; 37(5):1784-1793. doi: hps://doi. org/g7mvt4 [48] Coggins SJ, Norris JM, Malik R, Govendir M, Hall EJ, Kimble B, Thompson MF. Outcomes of treatment of cats with feline infecous peritonis using parenterally administered remdesivir, with or without transion to orally administered GS-441524. J. Vet. Intern. Med. [Internet]. 2023; 37(5):1772-1783. doi: hps://doi.org/ qsx9 [49] Anwer AZ, Abdulkader MS, Massieh ESA. Outcomes of Treatment of Cats with Effusive Feline Infecous Peritonis Using Parenterally Administered Remdesivir with Two Different Maintenance Dose Concentraons. Kaas Univ. Vet. Fak. Derg. [Internet]. 2025; 31(2):259-266. doi: hps://doi.org/qszc [50] Ritz S, Egberink H, Hartmann K. Effect of feline interferon- omega on the survival me and quality of life of cats with feline infecous peritonis. J. Vet. Intern. Med. [Internet]. 2007; 21(6):1193-1197. doi: hps://doi.org/c8sfrz [51] Fischer Y, Ritz S, Weber K, Sauter-Louis C, Hartmann K. Randomized, placebo controlled study of the effect of propentofylline on survival me and quality of life of cats with feline infecous peritonis. J. Vet. Intern. Med. [Internet]. 2011; 25(6):1270-1276. doi: hps://doi.org/ bg49h8 [52] Ishida T, Shibanai A, Tanaka S, Uchida K, Mochizuki M. Use of recombinant feline interferon and glucocorcoid in the treatment of feline infecous peritonis. J. Feline Med. Surg. [Internet]. 2004; 6(2):107-109. doi: hps:// doi.org/dz9q 11 of 11