https://doi.org/10.52973/rcfcv-e33278
Received: 05/06/2023 Accepted: 04/08/2023 Published: 22/08/2023
1 of 7
Revista Científica, FCV-LUZ / Vol. XXXIII, rcfcv-e33278
ABSTRACT
Cyclophosphamide (CP) is one of the frequently preferred
chemotherapeutic agents Worldwide. CP has negative effects on
the testes, spermatogenesis, and reproductive hormones. The aim
of this study was to determine the protective effect of Coenzyme Q10
(CoQ10) on the damage caused by CP. CoQ10 is use in the treatment
of infertility problems and is naturally found in the testes and seminal
uid. Thirty–six Albino Wistar male rats were divided into six groups
(Control, Sham, Cyclophosphamide (CP), Coenzyme Q10 (CoQ10),
CP + CoQ10 I, CP + CoQ10 II), with six animals in each group. Semen
analysis included investigations of sperm DNA damage, motility,
abnormal sperm ratio, and density. Histopathological examination
and assessment of oxidative stress parameters in the testes were
conducted. Additionally, serum levels of FSH, LH, and Testosterone
were measured. CoQ10 administration increased the motility rate,
density, and Testosterone levels in testicular damage caused by CP
(P<0.05). Furthermore, it was observed that the abnormal sperm ratio,
sperm DNA damage, and oxidative stress were reduced (P<0.05).
Based on the results of this study, the use of CoQ10 in conjunction
with CP has the potential to alleviate male infertility problems that
may arise from CP administration.
Key words: Coenzym Q10; cyclophosphamide; sperm; testis
RESUMEN
La ciclofosfamida (CP) es uno de los agentes quimioterapéuticos
preferidos en todo el mundo. La CP tiene efectos negativos sobre
los testículos, la espermatogénesis y las hormonas reproductivas.
El objetivo de este estudio era determinar el efecto protector de
la coenzima Q10 (CoQ10) sobre los daños causados por la CP. La
CoQ10 se utiliza en el tratamiento de problemas de infertilidad y se
encuentra de forma natural en los testículos y el líquido seminal. Se
dividieron 36 ratas macho Albino Wistar en seis grupos (Control,
Sham, Ciclofosfamida (CP), Coenzima Q10 (CoQ10), CP + CoQ10 I, CP
+ CoQ10 II), con seis animales en cada grupo. El análisis del semen
incluyó investigaciones del daño del ADN espermático, la motilidad, la
proporción de espermatozoides anormales y la densidad. Se realizó un
examen histopatológico y una evaluación de los parámetros de estrés
oxidativo en los testículos. Además, se midieron los niveles séricos
de FSH, LH y testosterona. La administración de CoQ10 aumentó
la tasa de motilidad, la densidad y los niveles de testosterona en el
daño testicular causado por CP (P<0,05). Además, se observó que se
redujo la proporción anormal de espermatozoides, el daño del DNA
espermático y el estrés oxidativo (P<0,05). En base a los resultados
de este estudio, el uso de CoQ10 junto con CP tiene el potencial de
aliviar los problemas de infertilidad masculina que pueden surgir de
la administración de CP.
Palabras clave: Ciclofosfamida; coenzima Q10; esperma; testículo
Investigation of the effect of Coenzyme–Q10 on Cyclophosphamide induced
testicular damage in male rats
Investigación del efecto de la coenzima Q10 sobre el daño testicular inducido por
ciclofosfamida en ratas macho
Volkan Koşal
1
* , İhsan Rua
2
, Veysel Yüksek
3
, Ömer Faruk Keleş
4
1
Van Yuzuncu Yil University, Faculty of Veterinary Medicine, Department of Articial Insemination. Van, Turkey.
2
Private Clinic, Department of Obstetrics and Gynecology. Van, Turkey.
3
Van Yuzuncu Yil University, Faculty ofVeterinary Medicine, Department of Biochemistry. Van, Turkey.
4
Van Yuzuncu Yil University, Faculty of Veterinary Medicine, Department of Pathology. Van, Turkey.
*Corresponding Author: volkankosal@yyu.edu.tr
Effect of Coenzyme-Q10 on Cyclophosphamide in Testes / Koşal et al. _____________________________________________________________
2 of 7
INTRODUCTION
Cyclophosphamide (CP) is one of the most commonly used
chemotherapeutic drugs in both Veterinary and Human Health [1].
Apart from its use in cancer treatment, it is also employed as
an immunosuppressive drug in autoimmune diseases and organ
transplants [2]. CP has a cytotoxic alkaline nature, and its metabolites,
aldophosphamide mustard and acrolein, inhibit deoxyribonucleic acid
(DNA) synthesis [3, 4]. Due to its ability to penetrate the blood–testicular
barrier, CP and its metabolites cause various dysfunctions in the testes,
including decreased testicular weight, loss of germ cells, degeneration
of Tubulus Seminiferus Contortus, oligospermia, azoospermia, increased
oxidative stress, and decreased Testosterone levels [5, 6, 7].
Coenzyme Q10 (CoQ10) is often preferred in the treatment of
idiopathic male infertility problems. It is widely distributed in tissues and
organs and exhibits prolonged action [8]. CoQ10 plays a role in energy
mobilization and protection against lipid peroxidation in spermatozoa
[9]. Acting on mitochondria, CoQ10 serves as an electron carrier and
reduces oxidative stress [10]. Mitochondria, located in the middle part
of spermatozoa, are responsible for various metabolic activities such
as steroid synthesis, energy production, calcium metabolism, and cell
apoptosis [11]. CoQ10, distributed in these mitochondria, acts as an
energy promoter and antioxidant [12]. It is involved in gene expression,
membrane stability, and cell signaling, protecting cells from damage
and abnormal growth [13]. CoQ10 protects cells against apoptosis,
increases energy levels, and possesses anti–inammatory properties.
Furthermore, its nanoparticle structure enables it to penetrate the
blood–testis barrier [14, 15].
The aim of this study was to investigate the protective effect of
CoQ10 on CP–induced testicular damage at different time points,
focusing on the testes, semen, sperm DNA damage, and reproductive
hormones.
MATERIAL AND METHODS
Animals
Adult, pathogen–free male Albino Wistar rats (Rattus norvegicus)
were obtained from Van Yuzuncu Yil University. The animals used in
the study were approximately 3–4 months old and weighed between
200–250 g. They were provided with ad libitum access to food and
water and were kept under a 12–h light–dark cycle. The housing
conditions maintained an average temperature of 22–24°C and
relative humidity of 55–60%. Each cage contained 6 animals, and
the experiment was conducted with these groups.
Groups
Control (n=6): 0.5 mL of physiological saline daily administered by
oral gavage for 4 weeks
Sham (Olive Oil) (n=6): 0.5 mL of olive oil (Olea europaea) daily
administered by oral gavage for 4 weeks (Coenzyme Q10 (CoQ10)
dissolves in olive oil).
Cyclophosphamide (CP) (n=6): CP (Endoxan, Eczacıbaşı, Turkey)
at a dose of 6 mg·kg
-1
was dissolved in 0.5 mL of physiological saline
and administered by oral gavage for 4 weeks.
Coenzyme Q10 (CoQ10) (n=6): CoQ10 (Ocean, Germany) at a dose
of 2.8 mg·kg
-1
was dissolved in 0.5 mL of olive oil and administered
by oral gavage for 4 weeks.
CP + CoQ10 I (n=6): 6 mg·kg
-1
CP + 2.8 mg·kg
-1
CoQ10 administered
by oral gavage for 4 weeks.
CP + CoQ10 II (n=6): 6 mg·kg
-1
CP administered by oral gavage for 4
weeks + 2.8 mg·kg
-1
CoQ10 administered by oral gavage at 3 and 4 weeks.
Sperm examination
Motility examination (Progressive motility)
The sperm sample was obtained by epididymis puncture immediately
after sacrice and was placed on a glass slide on the heating table
(Mshot, TP–R282–M, China) set to 38°C. The coverglass was closed at an
angle of 45° and motility (in %) detected by microscopy (Nikon, Eclipse
E200, Japan), at 40x magnication. Uniform, linear, forward–moving
spermatozoa were compared to immobile, swirling and quivering
spermatozoa [16].
Density analysis
After epididymal puncture, 0.1 mL of sperm sample was added to
Eppendorf tubes with 0.5 mL Hayem solution (Norateks, Germany). Sperm
count per mL was calculated on a Thoma cell counting chamber [16].
Abnormal sperm ratio
The sperm obtained by epididymis puncture was transferred to
Eppendorf tubes with 0.5 mL Hancock solution (Norateks, Germany).
At least 400 sperm samples were examined at 40x magnication to
determine the ratio. The proportion of spermatozoa with anomalies
in the head, tail and neck part was determined [16].
Sperm DNA damage
The DNA Fragmentation Index was assessed using the Halomax®
kit (Spain). Sperm DNA damage was calculated following the protocol
of the Halotech Halomax HT–RN40 kit. A total of 600 sperm were
counted for each group, and the damage ratio was calculated using
the following formula:
SpermDNA fragmentation(SDF)
TotalSperm Counted
Fragmented Degraded
=
+
Oxidative stress
Collection of tissue samples for RNA isolation and preparation for
analysis
Testicular tissues were collected under sterile conditions and
stored at –80 °C (ILDAM, DF–210, Turkey) until the study day. On the
study day, the tissues were allowed to thaw at room temperature,
and approximately 30 mg of tissue was taken into sterile tubes. The
tissues were then homogenized by adding 0.2 mL of sterile phosphate
buffer. The homogenized tissues were centrifuged (Hettich, Rotox
32, Germany), and the liquid portion of the tube was discarded. The
pellet was used for total Ribonucleic acid (RNA) isolation.
RNA extraction and analysis – cDNA extraction
Total mRNA was extracted from the obtained pellets using the
Trizol Reagent–chloroform method [7]. The amount and purity of the
extracted mRNA were measured using a spectrometer (Biochrom,
______________________________________________________________________Revista Cientifica, FCV-LUZ / Vol. XXXIII, rcfcv-e33278
3 of 7
Anthos Zenyth 200RT, UK). A nanodrop spectrophotometer device
(BioDrop, UK) was used for the quantitative evaluation of total RNA.
To obtain complementary DNA (cDNA), reverse transcription was
performed using the Wizscript kit (Wizbio WizScript cDNA Synthesis
Kit, Korea) according to the protocol, with the Rotor–Gene Q Software–
Run device. The expression levels of oxidative/antioxidant genes
(GPX1, NCF1, NOS2, SOD1) were analyzed.
Real Time–qPCR
Using the obtained cDNAs, the mRNA transcription levels of the
target genes (GPX1, NCF1, SOD1, NOS2) were determined in TABLE I.
processing. They were embedded in paraffin blocks, and 4 μm
sections were obtained using a microtome (Leica, RM2235, Germany).
The sections were stained with hematoxylin and eosin (H–E) and
examined under a light microscope. Morphological ndings were
photographed and evaluated.
ELISA (FSH, LH, Testosterone)
Blood samples were collected in Ethylenediaminetetraacetic acid
(EDTA) tubes and centrifuged at 1,118 G for 15 min to separate the
serum. The serum samples were then analyzed using the FSH (AD3200
Ra), LH (AD1683 Ra), and Testosterone (AD1386 Ra) ELISA kits following
the protocols provided by Andy Gene, USA.
Statistical analysis
Statistical analysis was performed using the SPSS v.20 software
package (Chicago, IL, USA). All data were expressed as mean ± standard
deviation. One–way ANOVA followed by post hoc multiple comparisons
(Tukey's test) was used for comparative analysis between the groups.
A P–value of less than 0.05 was considered statistically signicant.
RESULTS AND DISCUSSIONS
Sperm examination
The motility and density parameters in the CP, CP+CoQ10 I, and
CP+CoQ10 II groups were signicantly lower compared to the other
groups (P<0.001). Additionally, the rates of abnormal sperm and
sperm DNA damage (FIG 1A–1F), were signicantly higher in the CP,
CP+CoQ10 I, and CP+CoQ10 II groups compared to the other groups
(P<0.001)(TABLE III).
ELISA (Hormone levels)
In the CoQ10 group, serum levels of Testosterone, FSH, and LH
showed a statistically signicant increase compared to the other
groups (P<0.001). On the other hand, in the CP group, the Testosterone
level was significantly decreased compared to the other groups
(P<0.001)(TABLE IV).
Oxidative stress
The GPX1 was statistically increased in the CoQ10, CP+CoQ10 I, and
CP+CoQ10 II groups (P<0.001). NCF1 gene expression was signicantly
increased in the CoQ10 group (P<0.001) and decreased in the CP,
CP+CoQ10 I, and CP+CoQ10 II groups (P<0.001). SOD1 was statistically
increased in the CP+CoQ10 I and CP+CoQ10 II groups (P<0.001)(TABLE V).
In paired comparisons between the CP group and the CP+CoQ10
I and CP+CoQ10 II groups, it was found that sperm motility, density,
and NCF1 gene expression statistically increased, while sperm DNA
damage and abnormal sperm rates statistically decreased (P<0.05).
Histopathological ndings
Microscopically, the testicular sections from the Control group
(FIG.2A), Sham group (FIG.2B), and CoQ10 group (FIG.2C) exhibited
normal histological appearances. Spermatogenesis was found to
be higher in the testicles of rats in the CoQ10 group compared to the
Control and Sham groups. In contrast, the CP group showed noticeable
changes in the testicular tissue. There was diffuse loss of spermatozoa
in the tubular lumens, and germ cells appeared dissociated from the
TABLE I
Primary sequence sequence of target genes
Gene
Primary sequence sequencing
F: 5’→3’ R: 5’→3’
Actin Beta (ACTB)
CTCCTCAAGGATGGCACC GCTCATTGTAGAAAGTGTGGT
GPX–1
TCCACCGTGTATGCCTTCTC TCTCTTCATTCTTGCCATTCTCC
NCF1
GTCGGAGAAGGTGGTCTACAG CGATAGGTCTGAAGGATGATGG
SOD1
GCTTCTGTCGTCTCCTTGCT CATGCTCGCCTTCAGTTAATCC
NOS2
TCTTCAGAGTCAAATCCTACCA TCTATTTCCTTTACGGCTTCC
Optimized primer conditions were determined for each gene. An
example of RT–qPCR reaction conditions is provided in TABLE II. The
RT–qPCR reactions were performed using the ROTOR–GENE Q system
(Qiagen, Germany). To determine gene expression patterns related
to oxidative stress, the transcription levels of GPX1, NCF1, SOD1, and
NOS2 were measured. ACTB (Actin Beta) was used as a control gene in
the expression analysis. SYBR Green master mix (ENZO Life Science,
cat: ENZ–NUC104–0200) was used for amplication detection. The
Ct (cycle threshold) values were determined at the beginning of the
logarithmic phase of the amplications for each sample. The gene
expression was analyzed using the 2–ΔΔCt method, and the fold
changes in expression were compared to the control group.
Histopathological examination
At the end of the experiment, necropsies were performed on
the rats, and samples of testis tissue were collected. The tissue
pieces were xed in Bouin's solution and underwent routine tissue
TABLE II
RT–qPCR Reaction conditions
Reaction content For one sample Reaction Cycle
Tampon (2X) 10 µL 95°C | 2 min denaturation
Primer and control
Primer (Actin Beta)
Forward : 0.5 µl
Reverse : 0.5 µl
95°C | 5 s
*58°C – 60°C
40 cycle
dH2O 8.4 µL
cDNA 0.6 µL
Total 20 µL
*: The binding temperature varied according to the primers.
Melting Curve
: Ramp
50–99
°C
(1
°C
increment) 90ºC | 5 s
FIGURE 1. Sperm DNA damage. Control (A), Sham (B), CoQ10 (C), CP (D), CP+CoQ10 I (E) and CP+CoQ10 II (F) groups
Effect of Coenzyme-Q10 on Cyclophosphamide in Testes / Koşal et al. _____________________________________________________________
4 of 7
TABLE III
Sperm parameters (Motility, Density, Abnormal sperm) and Sperm DNA Damage results
Control Sham CP CoQ10 CP+CoQ10 I CP+CoQ10 II
Motility (%) 83.33 ± 5.16 85.00 ± 5.47 55.00 ± 5.47*
a
86.66 ± 5.16 68.33 ± 7.52*
b
60.00 ± 6.32*
b
Density (x10
9
) 2.19 ± 0.15 2.20 ± 0.13 1.69 ± 0.06*
a
2.34 ± 0.05 1.96 ± 0.09*
b
1.8 ± 0.19*
b
Abnormal sperm (%) 17.00 ± 1.26 16.33 ± 1.21 44.66 ± 3.72*
a
16.50 ± 1.37 30.16 ± 4.21*
b
37.83 ± 3.43*
b
Sperm DNA Damage (%) 15.3 15.5 42.6*
a
11.6 30.1*
b
33.6*
b
*means: statistically signicant difference between the groups in the same row (P<0.001),
a,b
means: statistically signicant difference in
pairwise comparisons (CP–CP+CoQ10 I and CP–CP+CoQ10 II) (
P<0.05)
TABLE IV
Hormone levels (FSH, LH, Testosteron)
Control Sham CP CoQ10 CP+CoQ10 I CP+CoQ10 II
FSH (pg·mL
-1
) 367.48±23.31 384.66±12.17 379.36±21.32 415.73±13.91* 370.40±35.69 382.39±44.08
LH (pg·mL
-1
) 220.01±26.35 232.11±64.56 251.83±19.20 308.53±19.50* 253.37±40.22 220.81±53.22
Testosterone (pg·mL
-1
) 167.80±14.75 172.77±7.28 136.38±21.17* 185.95±7.03* 168.90±14.85 166.72±7.84
*means; statistically signicant difference between the groups in the same row (
P<0.001)
TABLE V
Oxidative stress (GPX1, NCF1, SOD1, NOS2) results
Control Sham CP CoQ10 CP+CoQ10 I CP+CoQ10 II
GPX1 1.11 ± 0.17 0.90 ± 0.16 1.20 ± 0.20 2.73 ± 0.39* 5.07 ± 1.72* 2.50 ± 0.49*
NCF1 1.10 ± 0.09 0.81 ± 0.05 0.19 ± 0.18*
a
5.34 ± 1.68* 0.48 ± 0.09*
b
0.56 ± 0.18*
b
NOS2 0.95 ± 0.15 0.85 ± 0.63 0.87 ± 0.41 1.20 ± 0.07 1.02 ± 0.28 1.06 ± 0.28
SOD1 0.95 ± 0.06 1.21 ± 0.48 0.97 ± 0.32 1.03 ± 0.45 3.51 ± 0.65* 3.99 ± 0.59*
*means: statistically signicant difference between the groups in the same row (
P<0.001),
a,b
means: statistically signicant
difference in pairwise comparisons (CP–CP+CoQ10 I and CP–CP+CoQ10 II) (
P<0.05)
FIGURE 2. Histopatology of Testes. Histopathological appearance of cross–sections of the rat testes (H&E staining, Bar; 100 μm). Control (A), Sham (B) and CoQ10 (C)
groups showed normal seminiferous tubule morphology and spermatogenic cells in advanced stages. CP group showed arrested spermatogenesis (*). The seminiferous
tubules were irregular and shrunken. In the lumen of the seminiferous tubules desquamated degenerated spermatogonia were obserrved. In CP+CoQ10 I (E) and
CP+CoQ10 II (F) groups the morphology of the seminiferous tubules were almost normal
______________________________________________________________________Revista Cientifica, FCV-LUZ / Vol. XXXIII, rcfcv-e33278
5 of 7
basal membrane. Additionally, several accumulations of immature
germinal cells were observed in the lumen of seminiferous tubules
(FIG.2D). However, in the CP+CoQ10 I and CP+CoQ10 II groups, these
histological abnormalities were signicantly reduced, and the testis
appeared closer to its normal histological appearance (FIG.2E–2F).
The testis is known to be highly susceptible to damage from
chemotherapeutic agents, metals, and clastogenic substances
[17]. The metabolites of chemotherapeutic drugs can disrupt DNA
synthesis in cells undergoing meiosis and mitosis, leading to cell
apoptosis and the production of reactive oxygen species (ROS) [18].
Cyclophosphamide (CP), a commonly used chemotherapeutic agent,
can cause damage to the testicles. This damage is primarily attributed
to the alkaline metabolites of CP, such as aldophosphamide mustard
and acrolein [19].
In this study and others studies carried out by applying CP, it has
been observed, that the sperm motility rate and density decrease,
the ratio of abnormal sperm increases, and sperm DNA damage is
enhanced. Additionally, histopathological damage to the testes,
decreased testosterone levels, and increased oxidative stress have
been detected [1, 3, 7, 19, 20, 21, 22, 23, 24, 25].
CoQ10 has been investigated in several studies for its effects on
testicular damage caused by various agents, including cadmium
[26], lead [27], radiation [17], and smoking [10] were investigated.
However, in the literature review, no study has been found regarding
the protective effect of CoQ10, administered at different time points,
on the damage induced by CP application.
When comparing Testosterone levels, it was observed that the CP
group had low levels, while the CoQ10 group had higher levels (P<0.001).
The CP+CoQ10 I and CP+CoQ10 II groups exhibited intermediate levels.
CoQ10 is believed to have a positive effect on Testosterone levels.
Testosterone is produced through enzymatic processes involving
StAR, P450, CYP11A1, CYP17A1, 3β–HSD, and 17β–HSD. CoQ10 enhances
Testosterone levels by facilitating the transport of cholesterol to the
outer mitochondrial membrane of StAR [28, 29, 30]. Conversely, CP
decreases Testosterone levels by inducing atrophy and toxicity in
Leydig cells [1, 21].
Sperm DNA damage was signicantly higher in the CP, CP+CoQ10I,
and CP+CoQ10 II groups (P<0.001). However, it was observed that the
CP+CoQ10 I and CP+CoQ10 II groups had lower DNA damage sizes
compared to the CP group (P<0.05). Sperm DNA damage is closely
associated with reactive oxygen species (ROS), lipid peroxidation,
and antioxidants. This study, along with several others [3, 4, 5] has
determined that CP leads to an increase in ROS and lipid peroxidation
in the testicles. CoQ10, being a natural antioxidant and ROS scavenger,
is naturally present in seminal uid [31, 32]. These inherent properties
of CoQ10 contribute to the reduction of sperm DNA damage and
oxidative stress (P<0.05).
The motility rate was found to be lower in the CP, CP+CoQ10 I, and
CP+CoQ10 II groups (P<0.001). However, it was observed that the
motility rate was improved in the CP+CoQ10 I and CP+CoQ10 II groups
(P<0.05). CoQ10 plays a role in maintaining the energy mobilization of
spermatozoa through its interaction with mitochondria, thus enhancing
the motility rate of sperm [9]. Mitochondria have various functions,
including steroid synthesis, energy production, and apoptosis regulation
[11]. CoQ10 helps minimize agellum and axonemal damage in the
spermatozoa structure, thereby maintaining the motility rate [21].
It was determined that the density decreased and the rate of
abnormal sperm increased in the CP group (P<0.001). In the pairwise
comparison between CP – CP+CoQ10 I and CP – CP+CoQ10 II, the
protective effect of CoQ10 becomes evident (P<0.05). In this study
and several studies on CP, it has been observed that CP leads to
Effect of Coenzyme-Q10 on Cyclophosphamide in Testes / Koşal et al. _____________________________________________________________
6 of 7
cytoplasmic vacuolization in tubules, nuclear membrane disorders,
necrotization [24], germ cell vacuolization [1], damage to the integrity
of the germinal epithelium [7], and loss of germ cells [6]These
histopathological changes in the testis have a negative impact on
spermatogenesis, density, and the rate of abnormal sperm.
CONCLUSIONS
Based on the results of this study, it was concluded that CoQ10 can
reduce the negative effects of Cyclophosphamide on testis, testicular
oxidative stress, sperm DNA damage and reproductive hormones, and
may have a protective effect on male reproductive fertility.
ACKNOWLEDGEMENTS
This study was supported by the Scienctic Research Projects
Coordination Unit of Van Yuzuncu Yil University as an individual
research project numbered TYD–2020–8834.
Ethical statement
This study was approved by the Van Yuzuncu Yil University Animal
Experiments Local Ethics Committee (YUHAD–YEK, Date: 28/11/2019;
Decision number: 2019/11).
BIBLIOGRAPHIC REFERENCES
[1] Alkhalaf MI, Alansari WS, Alshubaily FA, Alnajeebi AM, Eskandrani AA,
Tashkandi MA. Chemoprotective effects of inositol hexaphosphate
against cyclophosphamide–induced testicular damage in rats. Sci.
Rep. [Internet]. 2020; 10(1):12599. doi: https://doi.org/kp6d
[2] Türk G, Çeribaşi AO, Sakin F, Sönmez M, Ateşşahin A.
Antiperoxidative and anti–apoptotic effects of lycopene and
ellagic acid on cyclophosphamide–induced testicular lipid
peroxidation and apoptosis. Reprod. Fertil. Dev. [Internet].
2010; 22(4):587. doi: https://doi.org/bt44vx
[3] Fusco R, Salinaro AT, Siracusa R, D’Amico R, Impellizzeri D,
Scuto M. Hidrox® Counteracts Cyclophosphamide–Induced Male
Infertility through NRF2 Pathways in a Mouse Model. Antioxid.
[Internet]. 2021; 10(5):778. doi: https://doi.org/gm4jvs
[4] Le X, Luo P, Gu Y, Tao Y, Liu H. Squid ink polysaccharide reduces
cyclophosphamide‐induced testicular damage via Nrf2/ARE
activation pathway in mice. Iran J. Basic Med. Sci. 2015; 18(8):
4633467. PMID: 26557973.
[5] Gajjar R, Miller SD, Meyers KE, Ginsberg JP. Fertility preservation
in patients receiving cyclophosphamide therapy for renal
disease. Pediatr. Nephrol. [Internet]. 2015; 30(7):1099–106. doi:
https://doi.org/f7dtxn
[6] Smart E, Lopes F, Rice S, Nagy B, Anderson RA, Mitchell R.
Chemotherapy drugs cyclophosphamide, cisplatin and doxorubicin
induce germ cell loss in an in vitro model of the prepubertal testis.
Sci. Rep. [Internet]. 2018; 8(1):1773. doi: https://doi.org/gcxjm6
[7] Liu X, Li Q, Wang Z, Liu F. Identication of abnormal protein
expressions associated with mouse spermatogenesis induced by
cyclophosphamide. J. Cell Mol. Med. [Internet]. 2021; 25(3):1624–
32. doi: https://doi.org/kp6f
[8] Iftikhar A, Akhtar MF, Saleem A, Riaz A, Zehravi M, Rahman MDH.
Comparative Potential of Zinc Sulfate, L–Carnitine, Lycopene,
and Coenzyme Q10 on Cadmium–Induced Male Infertility. Intern. J.
Endocrinol. [Internet]. 2022; 2022:1–13. doi: https://doi.org/kp6g
[9] Pexoito de B. I, Haas RH. CoQ10 and Aging. Biol. [Internet]. 2019;
8(2):28. doi: https://doi.org/kp6h
[10] Lin YS, Liu CY, Chen PW, Wang CY, Chen HC, Tsao CW. Coenzyme
Q10 amends testicular function and spermatogenesis in male
mice exposed to cigarette. Ame. J. Transl. Res. [Internet]. 2021;
13(9):10142–10154. PMID: 34650686.
[11] Osellame LD, Blacker TS, Duchen MR. Cellular and molecular
mechanisms of mitochondrial function. Best Pract. Res. Clin.
Endocrinol. Metab. [Internet]. 2012; 26(6):711–23. doi: https://
doi.org/f4hkdw
[12] Wu Y, Li H, Zhao X, Baki G, Ma C, Yao Y. Differential expression
of circRNAs of testes with high and low sperm motility in Yili
geese. Front. Genet. [Internet]. 2022; 13:970097. doi: https://
doi.org/kp6j
[13] Bentinger M, Brismar K, Dallner G. The antioxidant role of
coenzyme Q. Mitochondrion. [Internet]. 2007; 7:41–50. doi:
https://doi.org/c6hxfx
[14] Littarru GP, Tiano L, Belardinelli R, Watts GF. Coenzyme Q10,
endothelial function, and cardiovascular disease. BioFactors.
[Internet]. 2011; 37(5):366–73. doi: https://doi.org/fmtsvc
[15] Masoumi M, Salehi M, Angaji SA, Hashemi M. Effects of Coenzyme
Q10 and Diamond Nanoparticles on Ischemia–Reperfusion–
Induced Testicular Damages in Rats. GMJ. [Internet]. 2021;
10:e2029. doi: https://doi.org/kp6k
[16] Ax RL, Dally MR, Didin BA, Lenz RW, Love CC, Varner DD, Hagez
B, Bellin ME.
Semen Evaluation. In: Hafez ESE, Hafez B, editors.
Reproduction in Farm Animals. 7th ed. Hoboken (NJ): Wiley–
Blackwell; 2013. p 365–75.
[17] Naja M, Cheki M, Amini P, Javad A, Shabeeb D, Eleojo Musa A.
Evaluating the protective effect of resveratrol, Q10, and alpha–
lipoic acid on radiation–induced mice spermatogenesis injury:
A histopathological study. RM. [Internet]. 2019; 17(12):907–14.
doi: https://doi.org/kp6p
[18] Kehe K, Balszuweit F, Steinritz D, Thiermann H. Molecular
toxicology of sulfur mustard–induced cutaneous inammation
and blistering. Toxicol. [Internet]. 2009; 263(1):12–9. doi: https://
doi.org/b676s9
[19] Cao Y, Wang X, Li S, Wang H, Yu L, Wang P. The Effects of
L–Carnitine Against Cyclophosphamide–Induced Injuries in
Mouse Testis. Basic Clin. Pharmacol. Toxicol. [Internet]. 2017;
120(2):152–8. doi: https://doi.org/f9ndjk
[20] Niakani A, Farrokhi F. Decapeptyl ameliorates cyclophosphamide–
induced reproductive toxicity in male Balb/C mice:
histomorphometric, stereologic and hormonal evidences. Iran
J. Reprod. Med. [Internet]. 2013; 11(10):791–800. PMID: 24639699
[21] Hosseini A. Cyclophosphamide–induced testicular toxicity
ameliorate by American ginseng treatment: An experimental
study. Intern. J. Reprod. Biomed. 2018; 16(11):711–8. PMID:
30775687
______________________________________________________________________Revista Cientifica, FCV-LUZ / Vol. XXXIII, rcfcv-e33278
7 of 7
[22] Hamzeh M, Hosseinimehr S, Karimpour A, Mohammadi H,
Khalatbary A, Amiri F. Cerium oxide nanoparticles protect
cyclophosphamide–induced testicular toxicity in mice. Intern.
J. Prev. Med. [Internet]. 2019; 10(1):5. doi: https://doi.org/kp6r
[23] Briseño–Bugarín J, Hernández–Ochoa I, Araujo–Padilla X,
Mojica–Villegas MA, Montaño–González RI, Gutiérrez–Salmeán
G. Phycobiliproteins Ameliorate Gonadal Toxicity in Male Mice
Treated with Cyclophosphamide, Nutrients. [Internet]. 2021;
13(8):2616. doi: https://doi.org/kp6s
[24] Li J, You Y, Zhang P, Huang X, Dong L, Yang F, Yu X, Chang D.
Qianing tablets repair of blood–testis barrier dysfunction in rats via
regulating oxidative stress and p38 MAPK pathway. BMC Complem.
Med. Ther. [Internet]. 2022; 22(1):133. doi: https://doi.org/kp6t
[25] Özatı̇K FY, Özatı̇K O, Tekşen Y, Yı̇Ğı̇Taslan S, Ari NS. Protective and
therapeutic effect of hydrogen sulde on hemorrhagic cystitis and
testis dysfunction induced with cyclophosphamide. Turk J. Med.
Sci. [Internet]. 2021; 51(3):1530–42. doi: https://doi.org/kp6v
[26] Irani S, Zhandi M, Sadeghi M, Youse AR, Marzban H, Raeian‐
Naeini HR. The effect of dietary supplementation of coenzyme
Q10 on reproductive variables of cadmium‐challenged male
Japanese quails (Coturnix Japonica). Vet. Med. Sci. [Internet].
2023; 9(2):837–850. doi: https://doi.org/kp6w
[27] El–Khadragy M, Al–Megrin WA, AlSadhan NA, Metwally DM, El–
Hennamy RE, Salem FEH, Kassab RB, Abdel–Moneim AE. Impact of
Coenzyme Q10 Administration on Lead Acetate–Induced Testicular
Damage in Rats. Oxid. Med. Cell Longev. [Internet]. 2020; 2020:1–
12. doi: https://doi.org/gnsdxb
[28] Diemer T, Allen JA, Hales KH, Hales DB. Reactive Oxygen Disrupts
Mitochondria in MA–10 Tumor Leydig Cells and Inhibits Steroidogenic
Acute Regulatory (StAR) Protein and Steroidogenesis. Endocrinol.
[Internet]. 2003; 144(7):2882–91. doi: https://doi.org/ddcb6g
[29] Manna PR, Stetson CL, Slominski AT, Pruitt K. Role of the
steroidogenic acute regulatory protein in health and disease.
Endocrinol. [Internet]. 2016; 51(1):7–21. doi: https://doi.org/f8n3qd
[30] Tsao CW, Hsu YJ, Tseng XT, Chang TC, Tsao CH, Liu CY. Does
Coenzyme Q10 Supplementation Improve Testicular Function
and Spermatogenesis in Male Mice with Chronic Kidney Disease?
Biol. [Internet]. 2021; 10(8):786. doi: https://doi.org/kp6x
[31] Balercia G, Mosca F, Mantero F, Boscaro M, Mancini A, Ricciardo–
Lamonica G, Littaru G. Coenzyme q10 supplementation in infertile
men with idiopathic asthenozoospermia: an open, uncontrolled
pilot study. Fertil. Steril. [Internet]. 2004; 81(1):93–8. doi: https://
doi.org/djqpbn
[32] Smorag L, Zheng Y, Nolte J, Zechner U, Engel W, Pantakani DVK.
MicroRNA signature in various cell types of mouse spermatogenesis:
Evidence for stage–specifically expressed miRNA–221, –203
and –34b–5p mediated spermatogenesis regulation. Biol. Cell.
[Internet]. 2012; 104(11):677–92. doi: https://doi.org/kp6z
