Invest Clin 67(1): 73 - 91, 2026 https://doi.org/10.54817/IC.v67n1a06

Corresponding author: Qiong Wang. Endoscopy Center. Qilu Hospital of Shandong University. 107 Wenhuaxi Road,

Jinan, Shandong 250012, China. Tel: +86 13563606469. Email: Wangqiong7979@163.com

Withaferin-A induces apoptosis and

autophagy in colorectal cancer cell lines

via down-regulated expression of histone

deacetylase 1.

Qiong Wang1,2 and Caixia Li3

1Qilu Hospital of Shandong University, Jinan, Shandong, China.

2Endoscopy Center, Weifang NO.2 People's Hospital, Weifang, Shandong, China.

3Department of Stomatology, Shandong Provincial People’s Hospital, Jinan, Shandong,

China.

Keywords: Apoptosis; Autophagy; Histone Deacetylase 1; Aberrant Crypt Foci;

Chemoprevention.

Abstract. Colorectal cancer (CRC) remains the third most common malig-

nancy worldwide, and there is an urgent need for low-toxicity, mechanism-based

preventives or adjuvants. Withaferin-A (WA), a plant-derived steroidal lactone,

exhibits broad antitumor activity; however, its role in CRC and its interactions

with epigenetic regulators, such as histone deacetylase 1 (HDAC1), remain un-

clear. Therefore, we investigated whether WA suppresses CRC growth by down-

regulating HDAC1 while inducing apoptosis and autophagy. Caco2 and HT-29

cells were treated with 0–5 µM WA; viability, colony formation, and migration de-

creased significantly (IC₅₀ 0.70–1.52 µM). Techniques such as Annexin-V/7-AAD

flow cytometry, MDC staining, TEM, and LC3B immunofluorescence showed that

1 µM WA notably increased apoptosis and autophagic flux, along with reduced

HDAC1 and p62 levels, higher LC3B-II/I ratios, and an increased Bax/Bcl-2 ratio.

Overexpression of HDAC1 via a lentiviral vector reversed these effects, confirming

dependence on HDAC1. For translational relevance, eight-week-old C57BL/6J

mice were first exposed to the food-borne carcinogen IQ (2-amino-3-methyl-3H-

imidazo[4,5-f]quinoline, 100 mg/kg) every other day for three weeks to induce

aberrant crypt foci (ACF). Starting the day after the first IQ dose, animals re-

ceived WA (2 mg/kg) or vehicle (corn oil) by gavage every other day for the same

period. WA reduced the number of macroscopic ACF by more than 60%, restored

HDAC1-related LC3B and p62 expression to normal levels, and showed no toxic-

ity based on body weight or general health assessments. These findings suggest

that WA provides potent, low-toxicity chemopreventive effects against CRC lesion

formation through HDAC1-dependent induction of apoptosis and autophagy, sup-

porting its further consideration as a preventive or adjuvant agent.

74 Wang and Li

Investigación Clínica 67(1): 2026

La withaferina-A induce la apoptosis y la autofagia en líneas

celulares de cáncer colorrectal mediante la regulación negativa

de la expresión de la histona deacetilasa 1.

Invest Clin 2026; 67 (1): 73 – 91

Palabras clave: Apoptosis; Autofagia; Histona Desacetilasa 1; Focos de Criptas

Aberrantes; Quimioprevención.

Resumen. El cáncer colorrectal (CCR) sigue siendo la tercera malignidad

más común en todo el mundo, y existe una necesidad urgente de preventivos o

adyuvantes de baja toxicidad basados en mecanismos. Withaferin-A (WA), una

lactona esteroide derivada de plantas, ha mostrado una amplia actividad antitu-

moral, pero su papel en el CRC y su interacción con reguladores epigenéticos,

como la histona deacetilasa 1 (HDAC1), no están claros. Por lo tanto, se evaluó

si WA suprime el crecimiento de CRC al regular la actividad de HDAC1 hacia

abajo e inducir concomitantemente apoptosis y autofagia. Las células Caco2 y

HT-29 se expusieron a WA 0–5 µM; la viabilidad, la formación de colonias y la mi-

gración se inhibieron marcadamente (IC₅₀ 0.70–1.52 µM). La citometría de flu-

jo con Annexin-V/7-AAD, la tinción con MDC, la inmunofluorescencia de TEM

y de LC3B mostraron que WA a 1 µM aumentó significativamente la apoptosis

y el flujo autofágico, acompañados de la regulación descendente de HDAC1 y

p62, la regulación ascendente de LC3B-II/I y un aumento en la relación Bax/

Bcl-2. La sobreexpresión de HDAC1 mediada por lentivirus revertió todos estos

efectos, lo que confirma la dependencia de HDAC1. Para evaluar la relevancia

traslacional, a ratones C57BL/6J de ocho semanas de edad se les administró

primero el carcinógeno el carcinógeno de origen alimentario, 2-amino, 2-ami-

no-3-metil-3H-imidazo[4,5-f]quinoline (100 mg/kg), cada dos días durante 3

semanas, para inducir focos de cripta aberrantes (ACF). A partir del día siguien-

te a la primera dosis de carcinógeno, los animales recibieron, adicionalmente,

WA (2 mg/kg) o vehículo (aceite de maíz) por gavage cada dos días durante el

mismo período. WA redujo el número macroscópico de ACF en más del 60%,

restableció la expresión de LC3B y p62 asociada a HDAC1 a niveles normales

y no mostró toxicidad ni en el peso corporal ni en el monitoreo general de la

salud. Estos datos indican que WA ejerce una quimioprevención potente y de

baja toxicidad contra la formación de lesiones de CRC mediante la inducción

de apoptosis y autofagia dependientes de HDAC1, lo que respalda su desarrollo

adicional como agente preventivo o adyuvante.

Received: 15-10-2025 Accepted: 21-12-2025

INTRODUCTION

Colorectal cancer (CRC) is the third

most diagnosed malignancy and the second

leading cause of cancer-related death world-

wide 1. Despite advances in surgery, radiother-

apy, and targeted agents, the 5-year survival

rate of patients with advanced CRC remains

below 20%, largely because of chemo-resis-

tance and dose-limiting toxicities 2. There-

fore, the development of low-toxicity, mech-

anism-based preventive or adjuvant therapies

is urgently needed.

Withaferin-A induces apoptosis and autophagy in colorectal cancer cells 75

Vol. 67(1): 73 - 91, 2026

Plant-derived small molecules have

gained prominence due to their widespread

antitumor effects and favorable safety pro-

files 3. Withaferin-A (WA), a steroidal lactone

derived from Withania somnifera, has dem-

onstrated potent antiproliferative, proapop-

totic, and antimetastatic effects across vari-

ous solid tumors 4-6. These effects are linked

to proteasome inhibition, reactive oxygen

species production, and modulation of key

cancer-related signaling pathways, including

STAT3 and NF-κB 7–9. However, the role of WA

in CRC and the exact molecular mechanisms

underlying its activity remain incompletely

understood.

An increasing body of evidence suggests

that epigenetic dysregulation—especially

abnormal histone acetylation—plays a key

role in CRC initiation and progression10,11.

Histone deacetylases (HDACs) remove acetyl

groups, thereby repressing tumor-suppressor

genes, and HDAC1 is often overexpressed in

CRC tissues 12,13. Small-molecule HDAC in-

hibitors (e.g., Trichostatin A) can restore

acetylation balance and induce growth arrest

or apoptosis, but their clinical use is limited

by systemic toxicity 14. Whether WA affects

HDAC activity in CRC remains unexplored.

The present study, therefore, aimed to

evaluate the anti-proliferative, pro-apoptot-

ic, and anti-migratory effects of WA in hu-

man CRC cell lines and to determine whether

these effects are mediated by downregula-

tion of HDAC1-dependent epigenetic mecha-

nisms. To assess translational relevance, we

also examined WA activity in a murine model

of colitis-associated CRC.

MATERIALS AND METHODS

Cell lines and culture conditions

Caco2 and HT-29 human CRC cells

were obtained from Shanghai ZhongQiao

Xin Zhou Biotechnology Co., Ltd. They were

grown as monolayers in Dulbecco’s Modi-

fied Eagle Medium (DMEM) (Gibco; Thermo

Fisher Scientific, Inc.). The human CRC cell

lines were supplemented with 10% fetal bo-

vine serum (FBS, Biological Industries, Is-

rael) and 1% penicillin/streptomycin (PEN/

STREP 100×, MILLIPORE, USA). Cells were

cultured in a humidified incubator at 37°C in

5% CO₂. The culture medium, including any

treatments, was replaced every 48 hours. All

treatments and controls contained a final di-

methyl sulfoxide (DMSO, D2650, Sigma-Al-

drich, USA) concentration of less than 0.1%.

Cell Counting Kit-8 (CCK8) assay

We used the CCK8 kit (K1018-5; APEx-

BIO, USA) to detect cell viability. A total of

5×103 cells in 100 µL per well were cultured

in five replicate wells of a 96-well plate in

medium containing 10% FBS and allowed

to adhere overnight. Then, the cells were

treated with various concentrations of WA

(W4394-5mg, Sigma-Aldrich, Saint Louis,

MO, USA) (0, 0.5, 1, 2, 3, 4, 5 µM) for 24

and 48 hours. WA was diluted in 0.1% DMSO.

Control cells were treated with 0.1% DMSO

in culture medium. Following the manufac-

turer’s instructions, 10 µL of CCK8 reagent

was added to 90 µL of DMEM to prepare a

working solution, which was then incubated

for 30 minutes at 37°C. 100 µL of the work-

ing solution was added to each well. The

absorbance (OD) was measured at 450 nm

using a microplate spectrophotometer (Vari-

oskan Flash 4.0, Thermo Fisher Scientific,

Waltham, MA, USA). All experiments were

performed in quintuplicate, with five wells

per replicate. The viability rate was calculat-

ed as: (OD test – OD blank) / (OD control –

OD blank) × 100%. The OD blank consisted

of wells with 0.1% DMSO in culture medium.

The half-maximal inhibitory concentration

(IC50) values were determined using Graph-

Pad 8.0. Subsequently, cells were treated in

complete medium with or without 1 µM WA

for future experiments.

Colony formation assay

CRC cells were seeded into 6-well plates

at a density of 1000 cells per well and cul-

tured with 0 or 1 µM WA. They were incu-

bated at 37°C for 14 days to allow colony for-

76 Wang and Li

Investigación Clínica 67(1): 2026

mation. Finally, the cells were washed with

phosphate-buffered saline (PBS), fixed in

methanol at room temperature for 30 min-

utes, washed again with PBS, and stained

with 0.1% crystal violet at room tempera-

ture for 30 minutes. After washing with PBS,

the wells were photographed with a smart-

phone camera (VIVO X6 PLUS, China), and

colonies with at least 50 cells were visually

counted and quantified.

Wound healing assay

Wound-healing assays were performed

to evaluate CRC cell motility. CRC cells were

seeded in 6–well plates at a density of 1×106

cells per well. After 24 h, the cell monolayer

was scratched with a 10µL pipette tip. The

wound-healing assay was performed in mono-

layer culture, after which the cells were cul-

tured in serum–free medium. Wounds were

washed with PBS and incubated in serum-free

medium in the presence of 0 or 1 µM WA. Im-

ages were captured at different timepoints

(0, 24 and 48 h). The wound-healing area was

calculated using ImageJ software (version

1.8.0.112; National Institutes of Health).

Transwell (Migration) assay

Migration ability was evaluated using

24-well Transwell chambers (8.0 µm pore

size; 3422, Corning Costar, USA). After

48 hours of treatment with the respective

agents, CRC cells were digested and sus-

pended in FBS-free medium. Subsequently,

1×105 cells were allowed to migrate from

the upper chamber, which contained 200 µL

of medium without FBS, to the lower cham-

ber, which contained 700 µL of medium with

30% FBS. After incubating the Transwells

for 24 hours, non-invading cells in the upper

chamber were removed with a cotton swab,

and cells that had invaded the membrane

were fixed in methanol for 5 minutes and

stained with crystal violet for 30 minutes.

The cells that migrated through the poly-

carbonate membrane were counted under a

Nikon Ti-E inverted microscope (5 random

fields per well, magnification ×100).

Analysis of apoptosis by Flow Cytometry

(FCM)

CRC cells were cultured in 60 mm dish-

es at a density of 1×106 cells per well and

treated with drugs for 24 hours as previously

described. An Annexin V-APC/7-AAD apopto-

sis detection kit was used to assess cell mor-

phology and apoptosis. Following the manu-

facturer’s instructions, cells were washed

twice with cold PBS, then collected and re-

suspended in 1× Annexin V Binding Buffer.

Next, 5 µL of Annexin V-APC conjugate and 5

µL of 7-AAD solution were added to the cell

suspension, which was incubated for 15 min-

utes at 2-8°C in the dark. Afterward, 400 µL

of 1× Annexin V Binding Buffer was added

to each tube. The samples were analyzed by

flow cytometry using a CytoFLEX Flow Cy-

tometer (Beckman Coulter, Inc., USA) with-

in 1 hour of staining. Data were analyzed

with CytExpert software.

Monodansylcadaverine (MDC) staining

MDC, an electrophoretic marker of au-

tophagosome formation, was used to quan-

tify autophagy induction. The autofluores-

cent drug MDC is a selective marker for

acidic vesicular organelles (AVOs), such as

autophagic vacuoles and autolysosomes. The

effects of WA and the control group on au-

tophagy levels in CRC cells were assessed us-

ing the MDC method. Normal cells displayed

a uniform yellow-green stain, while autopha-

gosomes appeared as densely packed green

granules of varying sizes, producing punc-

tate green fluorescence. In brief, after the

specified treatment conditions, cells were

seeded into a 6-well plate (3×106 cells/well)

and cultured overnight until reaching 50–

60% confluence. As described above, they

were divided into two groups for different in-

terventions. At the designated time points,

the original medium was removed, cells were

washed with 1× wash buffer (diluted in de-

ionized water), incubated with the prepared

MDC staining solution at room temperature

for 45 minutes in the dark, and then washed

three times with 1× wash buffer. Fluores-

Withaferin-A induces apoptosis and autophagy in colorectal cancer cells 77

Vol. 67(1): 73 - 91, 2026

cent images were captured using an invert-

ed fluorescence microscope (magnification

×200) (Nikon Microscope, Tokyo, Japan) at

an excitation wavelength of 355 nm and an

emission filter of 512 nm (Leica, Wetzlar,

Germany).

Ultra-structures observed by transmission

electron microscopy

To evaluate the effect of WA on cell

autophagy in CRC cells, cells were treated

with or without WA (1 µM) for 48 hours. The

cells were then washed with PBS, collected

by centrifugation at 1,000 × g (Eppendorf,

Hamburg, Germany), and fixed in cold (4°C)

2.5% glutaraldehyde solution (Servicebio

Technology Co., Ltd., Wuhan) for 1 hour. The

specimens were subsequently rinsed with 0.1

mL PBS, embedded in agarose for pre-em-

bedding, postfixed in 1% osmium tetroxide

(Ted Pella Inc., California, USA) in the dark

for 2 hours at room temperature, dehydrat-

ed through a graded series of ethanol solu-

tions (30-100%) and two changes of acetone

(Sinaopharm Group Chemical Reagent Co.,

Ltd.), and then infiltrated with EMBed 812

(SPI, USA) for resin penetration and embed-

ding. After polymerization, the resin blocks

were sectioned at 60–80 nm on a Leica UC7

ultramicrotome (Leica, Wetzlar, Germany),

and the tissues were transferred onto 150-

mesh copper grids coated with Formvar film.

Copper grids were stained with 2% uranyl

acetate in saturated alcohol for 8 minutes,

then with 2.6% lead citrate for 8 minutes,

with light exposure avoided during staining.

The grids were placed on the grid board and

dried overnight at room temperature. Rep-

resentative areas were examined with an

HT7800 transmission electron microscope

(Hitachi Ltd., Tokyo, Japan).

Immunofluorescence Assay

To further confirm that autophagy was

induced by WA, CRC cells were seeded into

24-well cell culture plates at a density of

1.5×105 cells per well. The cells were divided

into two groups as previously described. After

fixing with 4% paraformaldehyde, the cells

were permeabilized with 0.3% Triton X-100

for 5 minutes and blocked with 5% normal

goat serum for 1 hour. The cells were then

incubated with rabbit anti-LC3A/B primary

antibody (1:200) overnight at 4°C. After

washing with PBS, the cells were immunos-

tained with FITC-conjugated goat anti-rab-

bit secondary antibody (1:100) for 1 hour

at room temperature in the dark. Next, the

cell nuclei were stained with 4’,6-diamidino-

2-phenylindole (DAPI) for 3 minutes. Finally,

immunofluorescence images were captured

and observed using a fluorescence micro-

scope (magnification, ×400). The Dylight

488, Goat Anti-Rabbit IgG (cat. no. A23220;

1:500) was obtained from Abbkine Scientific

Co., Ltd., Wuhan, China.

RNA extraction, Reverse Transcription,

and RT-qPCR

CRC cells were treated with 1 µM WA

for the indicated duration (48 hours) and

harvested using TRIzol reagent (Invitrogen,

Thermo Fisher Scientific, Inc.). After add-

ing 1/5 volume of chloroform (Invitrogen,

Thermo Fisher Scientific, Inc.), the mixture

was centrifuged at 12000g for 15 minutes at

4°C, and the supernatants were transferred

to new, clear centrifuge tubes. An equal vol-

ume of isopropanol was added to each super-

natant and gently mixed. After incubation

at room temperature for 30 minutes, the

mixture was centrifuged at 12000g for 15

minutes. The pellets were washed once with

75% ethanol and dissolved in RNase-free wa-

ter at an appropriate volume. Following RNA

quantification, reverse transcription (RT)

reactions were performed to convert total

RNA into cDNA using the SureScript™ First-

Strand cDNA Synthesis Kit (cat. no. QP056,

GeneCopoeia, Inc., Guangzhou, China) and

reverse transcriptase (Takara, Tokyo, Japan)

according to the manufacturer’s protocol.

Cycling parameters were set at 95°C for 30

seconds (denaturation), 95°C for 5 seconds

(annealing), and 60°C for 34 seconds (exten-

sion), with 40 cycles performed.

78 Wang and Li

Investigación Clínica 67(1): 2026

The gene-specific primer sequences,

synthesized by Generay Biotech Co., Ltd.

(Shanghai, China) and derived from Prim-

erBank, are summarized in Supplemental

Table 1. GAPDH was used as an internal

control to normalize RNA quantity and qual-

ity across samples. The presence of HDAC1,

Bax, Bcl-2, p62, and LC3B transcripts was

analyzed by Quantitative RT-qPCR (10-µL re-

action volume) using the BlazeTaq™ SYBR®

Green qPCR Mix 2.0 Kit (cat. no. QP031,

GeneCopoeia, Inc., Guangzhou, China).

Real-time reverse transcription quantitative

PCR (RT-qPCR) was performed on an Ap-

plied Biosystems 7500 system according to

the manufacturer’s instructions. Data were

analyzed using the 2–ΔΔCq method, with rela-

tive quantification calculated by the formula

2–ΔΔCt, where ΔCt =Ct of target gene −Ct of

GAPDH, and ΔΔCt =ΔCt of treatment –ΔCt

of control.

Supplemental Table 1. Primers for RT-qPCR.

Gene Primer sequence, 5’3’

GAPDH F GGACCTGACCTGCCGTCTAG

R GTAGCCCAGGATGCCCTTGA

Bax F CCCGAGAGGTCTTTTTCCGAG

R CCAGCCCATGATGGTTCTGAT

Bcl-2 F GGTGGGGTCATGTGTGTGG

R CGGTTCAGGTACTCAGTCATCC

LC3B F AAGGCGCTTACAGCTCAATG

R CTGGGAGGCATAGACCATGT

HDAC1 F CGCCCTCACAAAGCCAATG

R CTGCTTGCTGTACTCCGACA

p62 F GACTACGACTTGTGTAGCGTC

R AGTGTCCGTGTTTCACCTTCC

F, forward; R, reverse.

Western blotting

Western blotting was performed to as-

sess protein expression levels of the anti-

apoptotic Bcl-2 and the pro-apoptotic Bax;

the autophagic markers LC3 II/I and p62;

and HDAC1. After the specified drug treat-

ments, total protein was extracted from

CRC cells at 48 hours. The cells were washed

twice with ice-cold PBS and lysed in com-

plete cell lysis buffer (50 mM Tris- HCl, pH

7. 4, 7.4,150 mM NaCl, 1% Triton X- 100,

0. 25% Na-Deoxycholate,1 mM EDTA, 1 mM

NaF, 1 mM dithiothreitol, 1 mM PMSF,1 mM

activated Na 3 VO 4, 0.02 µM aprotinin, 0.

16 µM leupeptin, and 0.22 µM pepstatin).

Protein extracts were heated at 99°C for 5

minutes and then cooled on ice. Protein con-

centrations were measured using a BCA pro-

tein assay kit (Tiangen Biotech Co., Ltd.).

Equal amounts (30 µg) of protein from each

sample were loaded and separated on a 10%

SDS-PAGE gel through 6–12% gels, then

transferred onto PVDF membranes (Milli-

pore, USA). The membranes were blocked

in rapid sealing fluid for 30 minutes, then

incubated overnight at 4°C with primary an-

tibodies. The blots were washed three times

for 5 minutes with TBST, then incubated

with specific secondary antibodies at room

temperature for 1 hour. After washing three

additional times for 5 minutes in TBST, the

bands were visualized with an ECL detec-

tion reagent, quantified using ImageJ, and

normalized to GAPDH as the endogenous

control. The antibody information is as fol-

lows: GAPDH (product no. 5174; 1: 1000

dilution), LC 3 A/B (product no. 12741; 1:

1000 dilution), and HDAC 1 (product no.

34589; 1: 1000 dilution) from Cell Signal-

ing Technology; p 62 (cat. no. ab 109012; 1:

2000 dilution) and Bax (cat. no. ab 182733;

1: 2000 dilution) from Abcam; Bcl- 2 (cat.

no. SC 271268; 1: 200 dilution) from Santa

Cruz Biotechnology. Goat anti- Rabbit IgG-

HRP (cat. no. HA 1001; 1: 10, 000 dilution)

and Goat anti- Mouse IgG- HRP (cat. no. HA

1006; 1: 5000 dilution) from Huaan Biotech-

nology, Co., Ltd. (Hangzhou, China). The

secondary antibody diluent buffer (P 0023

D- 100 mL) was obtained from Beyotime

Biotechnology (Shanghai, China).

Separation of the nucleus from

the cytoplasm

A nucleoprotein extraction kit was used

to separate the nucleus from the cytoplasm

Withaferin-A induces apoptosis and autophagy in colorectal cancer cells 79

Vol. 67(1): 73 - 91, 2026

according to the manufacturer’s protocol.

The CRC cells were washed three times with

cold PBS and collected into 1.5 mL Eppen-

dorf tubes using a cell scraper. Cells were

centrifuged at 500 × g for 3 minutes at 4°C,

and the supernatants were discarded. Cell

lysates were added to the precipitates. The

Eppendorf tubes were then vortexed for 15

seconds at 5-minute intervals, for a total of

3 cycles. Next, the suspensions were centri-

fuged for 5 minutes at 12,000 × g, and the

supernatants were collected as the cytoplas-

mic fraction. The nuclear lysates were added

to the precipitates. After vortexing for 15

seconds every 10 minutes for a total of 4

times, the suspensions were centrifuged for

10 minutes at 12,000 x g, and the superna-

tants contained the cytoplasmic proteins. Fi-

nally, the samples were packaged and stored

at -80°C for future use.

Histone acetyltransferase activity/

inhibition assay

Trichostatin A (TSA) is a specific inhibi-

tor of HDACs, and its inhibitory ability has

been validated in many experiments. Cells

were divided into three groups: control, WA,

and TSA. The control and WA groups were

treated with medium containing or lacking

WA, respectively. The TSA group cells were

pretreated with the inhibitor TSA. Nuclear

extracts were prepared as described above,

and the EpiQuik™ HDAC Activity/Inhibi-

tion Kit (Colorimetric) (P-4002) (Epigentek

Group Inc.) was used to determine whether

WA can inhibit HDACs in CRC cells similarly

to TSA. The assay was carried out according

to the provided protocol. Activity was ex-

pressed as relative OD values per mg protein

(OD/mg), based on triplicate measurements

(n=4). HDAC activity/inhibition assays were

performed either with or without HDAC in-

hibitors (HDACi). The inhibitory rate (%)

was calculated as: {1 - [OD (control – blank)

– OD (inhibitor sample – blank)] / [OD

(control – blank) – OD (no inhibitor sample

– blank)]} × 100%.

Lentivirus-mediated RNA interference

Lentiviral particles and Polybrene were

purchased from Shanghai Genechem Co.,

Ltd. The overexpressed gene was named LV-

HDAC1 (14721-1), and the negative control

(NC) was labeled as CON238. The procedure

was as follows: CRC cells were seeded in

6-well plates at a density of 1×105 cells per

well. Lentiviral particles with a multiplicity

of infection of 10 for HT-29 and 18 for Caco2

were added to the cells. GFP-expressing cells

were observed using fluorescence microsco-

py, and stable transfected cells were selected

with puromycin (8 µg/mL). After RNA and

protein were collected, and the interference

efficiency was calculated, the cells were

used for subsequent experiments. Levels of

HDAC1 mRNA and protein expression were

measured by RT-qPCR and Western blotting.

Previous research has shown that HDAC1

expression decreases upon WA treatment. It

was hypothesized that WA-induced apopto-

sis and autophagy in CRC cells were medi-

ated by HDAC1 downregulation. CRC cells

transfected with PCMV-HDAC1 or PCMV-NC

were treated with 1 µM WA for subsequent

experiments, including colony formation,

scratch healing, Transwell migration, flow

cytometry, Western blotting, and RT-qPCR

assays, to verify that WA-induced apoptosis

and autophagy were mediated by HDAC1

downregulation.

Studies in vivo

Eight-week-old C57BL/6J mice were

purchased from SiPeiFu Biotechnology Co.,

Ltd., Beijing. They were housed under stan-

dard laboratory conditions. The animals were

kept 3–5 per individually ventilated cage

(IVC) under specific-pathogen-free (SPF)

conditions at 22 ± 2°C, 40–60% relative hu-

midity, and a 12- hour light/12- hour dark

cycle (lights on from 07: 00 to 19: 00). Ster-

ilized squirrel cages, feed (high- fat diet),

bedding, and drinking water were regularly

replaced. WA (cat. no. T 5687- 250 mg),

used in mice, was obtained from Targetmol

80 Wang and Li

Investigación Clínica 67(1): 2026

Chemicals Inc. (Boston, USA). 2- amino- 3-

methyl- 3 H- imidazo [4, 5- f] quinoline IQ

was supplied by Toronto Research Chemi-

cals Inc. (Canada). Corn oil was purchased

from Jinlongyu, China. Mice were weighed,

and their initial body weights were recorded

before placement in the cage. Body weights

were measured again after 3 weeks on a

high- fat diet and prior to each oral (gavage)

drug/oil administration. The oil group re-

ceived 0.2 mL of oil; the IQ group received

100 mg/kg body weight; and the WA group

received 2 mg/kg body weight, with both IQ

and WA dissolved in corn oil, administered

once every two days. Mice were euthanized

by cervical dislocation. IQ, a potent hetero-

cyclic aromatic amine (HAA) formed dur-

ing high-temperature cooking of protein-

rich foods, is classified by the International

Agency for Research on Cancer as a Group

2A carcinogen. In rodents, oral gavage doses

of IQ can rapidly induce DNA adduct forma-

tion, chronic inflammation, and result in

aberrant crypt foci (ACF) within 3–4 weeks.

Eight-week-old C57BL/6J mice (n = 5 per

group) were acclimated for 1 week and then

maintained on a high-fat diet (Research Di-

ets D12492, 60% kcal from fat) to promote

tumor development. Colitis-associated ACF

was induced via gavage of IQ dissolved in corn

oil at 100 mg/kg body weight (0. 0,1 mL/10

g). Successful induction was defined as hav-

ing≥20 macroscopically visible ACF per

colon, along with histologically confirmed

dysplasia at necropsy in the IQ-alone group.

Body weight: mice were weighed before be-

ing placed in the cage, and initial weights

were recorded; body weights were also mea-

sured and recorded before each intragastric

gavage. General health status, including ac-

tivity, stool consistency, and rectal bleeding,

was assessed daily. This project was approved

by the Laboratory Animal Ethics and Welfare

Committee of Shandong University Qilu Col-

lege of Medicine (Approval number: 21099).

Bodies against HDAC1 (cat. no. 10197-

1-AP, 1:500) and LC3B (cat. no. 14600-1-AP,

1:1000) used in IHC were obtained from

Proteintech Biotechnology, Inc. (Wuhan,

China). Colorectal tissues were fixed in 4%

paraformaldehyde for 24 hours, dehydrated

through graded ethanol, cleared in xylene,

and embedded in paraffin. Sections 4 µm

thick were cut on a rotary microtome, de-

paraffinized, rehydrated, and stained with

hematoxylin for 5 minutes, followed by eo-

sin for 2 minutes. After dehydration and

mounting, whole-slide digital images were

captured at 200× magnification. Aberrant

crypt foci (ACF) were identified by two inde-

pendent investigators blinded to treatment

groups according to established morpho-

logical criteria. The percentage of ACF per

colon was calculated. Antigen retrieval was

performed by heating sections in 10 mM ci-

trate buffer (pH 6.0) at 95°C for 20 minutes.

Endogenous peroxidase activity was blocked

with 3% H₂O₂ in methanol for 15 minutes,

followed by 5% normal goat serum for 30

minutes. Sections were incubated overnight

at 4°C with primary antibodies: rabbit anti-

HDAC1 (Proteintech, 10197-1-AP, 1:500)

and rabbit anti-LC3B (Proteintech, 14600-1-

AP, 1:1000). After PBS washes, horseradish-

peroxidase-conjugated goat anti-rabbit IgG

(Huaan, HA1001, 1:200) was applied for 1

hour at room temperature. DAB was used

as the chromogen; sections were counter-

stained with hematoxylin, dehydrated, and

mounted. Five non-overlapping high-power

fields (HPF, 400×) per section were photo-

graphed. Integrated optical density (IOD) of

positive staining was measured using Image-

Pro Plus 6.0 (Media Cybernetics). Data were

normalized to the total tissue area in each

field and expressed as IOD/µm². Mean values

from five mice per group were used for sta-

tistical analysis.

Statistical analysis

GraphPad Prism 8.0.1 software was

used for statistical analysis. The results are

presented as mean ± SD (n≥3). Single-

point data (e.g., IC50 values, apoptotic index,

protein densitometry) were first tested for

normality (Shapiro–Wilk test) and homoge-

Withaferin-A induces apoptosis and autophagy in colorectal cancer cells 81

Vol. 67(1): 73 - 91, 2026

neity of variances (Levene’s test). Normally

distributed data were compared between two

groups using an unpaired Student’s t-test or

among three or more groups with one-way

ANOVA followed by Tukey’s post-hoc test.

Repeated measurements (such as CCK-8 vi-

ability assays and body-weight curves) were

analyzed with two-way repeated-measures

ANOVA (factors: treatment and time), fol-

lowed by Bonferroni’s post-hoc test when

an interaction was detected. The statistical

significance of differences between groups

(p<0.05) was assessed by one-way ANOVA.

RESULTS

Withaferin-A inhibits the proliferation and

motility/migration of CRC cells

To evaluate the anticancer effect of WA

on CRC cell lines, cells were treated with var-

ious concentrations of WA. The CCK8 assay

revealed that WA significantly reduced cell

viability in a dose- and time-dependent man-

ner compared to the control group (Fig. 1A-

C). The half maximal inhibitory concentra-

tion (IC50) values are shown in Table 1. Next,

the role of WA in colony formation was as-

sessed. Compared to the control group, the

number of colonies in the WA group was sig-

nificantly decreased (Fig. 1D and E). Chang-

es in the motility and migration capacity of

CRC cells were examined using wound heal-

ing and Transwell (migration) assays. De-

creased cell motility was observed in CRC

cells treated with WA. The 48-hour wound-

healing rate in the WA group differed signifi-

cantly from that in the control group (Fig.

1F and G). Cell migration capacity was also

reduced in the WA-treated group compared

with the control. Additionally, the number of

CRC cells migrating into the lower chamber

differed significantly (Fig. 1H and I). These

assay results indicate that cell proliferation,

migration, and overall activity were signifi-

cantly reduced in the WA group compared

with the control group.

Withaferin-A induces the apoptosis

of CRC cells

To confirm the effect of WA on cell apop-

tosis in CRC cells, cells treated with 0 and 1

µM of WA for 24 hours were analyzed by flow

cytometry. The data showed significant dif-

ferences in apoptosis rates among the CRC

cells; all results are presented in (Fig. 1J

and K). WA treatment increased apoptosis in

CRC cells, which inhibits their growth.

Withaferin-A induces the autophagy

of CRC cells

The results of MDC staining and TEM

assays are shown in (Fig. 2A–D). The data in-

dicate a significant difference in the number

of autophagosomes between the two groups.

As shown in the histogram, fluorescence

intensity analysis revealed that autophagic

vesicles in the WA group were significantly

higher than in the control group. Addition-

ally, LC3B fluorescence intensity indicated

a significant difference in autophagy levels

between the two groups (Fig. 2E and F).

Effect of Withaferin-A on HDAC1/LC3B /

p62/Bax and Bcl-2 expression in CRC cells

RT-qPCR was used to measure the

mRNA levels of LC3B, p62, Bax, and Bcl-

2 in response to WA. As shown in (Fig. 3A

- B), treatment with WA increased LC3B

and Bax mRNA levels and decreased p62

and Bcl-2 mRNA levels. Western blotting

was performed to detect the protein levels

of these molecules, with or without 1 µM

WA. The protein expression of HDAC1, p62,

Bax, Bcl-2, and the LC3B II/I ratio, as pre-

viously described, is shown in (Fig. 3C and

D). In summary, there were significant in-

creases in LC3B II/I and the Bax to Bcl-2

ratio in the WA treatment group, alongside

a reduction in p62 levels in total protein, as

demonstrated in (Fig. 3E and F). The mRNA

and total protein expression of HDAC1 were

similarly decreased in the WA-treated group

(Fig. 3G-I).

82 Wang and Li

Investigación Clínica 67(1): 2026

Histone Acetyltransferase Activity/

Inhibition Assay

The HDAC Activity/Inhibition Assay

demonstrated that WA can inhibit HDACs,

similar to Trichostatin A (TSA), a specific

HDAC inhibitor. The difference was statis-

tically significant (Fig.4A). HDAC1 expres-

sion was notably increased after transfection

with a lentiviral vector and purine screen-

ing. HDAC1 mRNA and protein levels were

measured by RT-qPCR and Western blot-

ting. The upregulation ratio also showed

a significant difference (Fig.4B-D). Cell

proliferation activity in the PCMV-HDAC1

group (HDAC1 overexpression) was signif-

icantly higher compared to the NC group

(Fig.4E-H). The CCK8 assay determined the

IC50 (Table 2) and revealed cell viability at

various doses and time points relative to

the control group. Additionally, cell motil-

ity and migration capacity increased in the

PCMV-HDAC1 group (Fig.4I-L).

Fig. 1. The molecular structure of WA (A) and the CCK8 assay demonstrated that WA significantly decreased cell

viability compared to the control group in a dose- and time-dependent manner. (B and C) IC50 values are provided

in Table 1. The number of colonies in both groups was quantified, as shown in the graphs, and the corresponding

histograms are included (D and E). Wound healing assay results and statistical graphs are shown in (F and G). The

number of cells migrating into the lower chamber (H and I) was significantly different. Apoptosis rates in the two

groups also showed significant differences (J and K). An unpaired Student’s t-test was used, with n=3 replicates,

* p<0.05, ** p<0.01, *** p<0.001. WA: Withaferin-A.

Table 1. IC50 of Withaferin-A in CRC Cells.

CRC Cells IC50 of WA (µM)

24h 48h

CACO2

HT-29

1.30

1.52

0.70

0.76

CRC: colorectal cancer; WA: Withaferin-A. IC50: half-

maximal inhibitory concentration; CACO2: human

colon adenocarcinoma-derived cell line; HT-29 human

colorectal adenocarcinoma epithelial cell line.

Withaferin-A induces apoptosis and autophagy in colorectal cancer cells 83

Vol. 67(1): 73 - 91, 2026

The apoptosis rates in the two groups

Flow cytometry analysis of apoptosis

was also significantly reduced in the PCMV-

HDAC1 group (Fig. 5A and B). Additionally,

mRNA expression levels of molecules involved

in apoptosis and autophagy were affected.

Bax and LC3B expressions were notably de-

creased, while p62 and Bcl-2 were markedly

increased in the PCMV-HDAC1 group (Fig.

5C and D). Protein expression levels of Bax/

Bcl-2 and LC3B-II/I were significantly lower,

whereas p62 levels were notably higher in the

PCMV-HDAC1 group (Fig. 5E-H).

The study in vivo

Eight-week-old C57BL/6J mice were

fed a high-fat diet for three weeks, then given

the colonic carcinogen IQ (100 mg/kg) by

gavage once every two days. Starting the day

after, animals were gavaged every two days

with either vehicle (corn oil) or Withaferin-A

(WA, 2 mg/kg) dissolved in corn oil (Fig. 6A,

B). Mice were weighed before being placed

in the cage, and initial weights were record-

ed; body weight was also measured before

each intragastric gavage. No significant dif-

ferences were observed among groups at any

time point, indicating that WA was well tol-

erated (Fig. 6C). After sacrifice, colons were

excised longitudinally and examined. WA-

treated mice showed a significant reduction

in the number and size of macroscopically

visible aberrant crypt foci (ACF) compared

to the IQ-only group (Fig. 6D). HE staining

Fig. 2. Experiments using MDC staining were conducted to measure autophagosomes in two groups. Histograms

indicated that autophagic vesicles in the WA group were significantly higher compared to the control group.

(A-B) TEM analysis is displayed in (C). An enlarged section of the spectrogram (black box) is shown below

(D). Autophagosome-like structures are marked with black arrows. Immunofluorescence analysis revealed

that LC3B fluorescence intensity, an autophagy marker, varied significantly between the two groups (E and

F). An unpaired Student’s t-test was used, with n=3 replicates, * p<0.05, ** p<0.01, **** p<0.0001. WA:

Withaferin-A; MDC: Monodansylcadaverine; TEM: Transmission Electron Microscope.

Monodansylcadaverine (MDC) staining

Caco2-Ctr Caco2-WA

HT-29-Ctr HT-29-WA

Caco2

Merge

HT-29

Merge

DAPI LC3B

LC3B

DAPI

84 Wang and Li

Investigación Clínica 67(1): 2026

was used to analyze the percentage of ACF.

Colorectal tissue slices from all three groups

were stained, revealing that ACF contained

crypt branching, distortion, atrophy, surface

irregularity, mucin depletion, Paneth cell

metaplasia, cryptitis, crypt abscesses, basal

plasmacytosis, or lymphoid aggregates, with

statistical significance (Fig. 6E). Represen-

tative immunohistochemical images and

quantitative analyses of LC3B and p62 ex-

pression from different groups are shown in

(Fig. 6F). Compared to the IQ group, the WA

group showed reduced LC3B and p62 posi-

tivity, indicating that WA can reduce the IQ-

induced increase in LC3B and p62 expres-

sion (Fig. 6F).

DISCUSSION

Over the last few decades, the use of

plant-derived edibles and the consumption of

highly active, naturally occurring or synthet-

ic, highly specific drugs have increased15-18.

Plant-derived natural molecules have fewer

side effects and are readily available. They

have been used in the treatment of various

Fig. 3. Significant increases in LC3B/Bax and decreases in Bcl-2/p62 mRNA levels were observed, along with

notable changes in protein expression of p62/Bax/Bcl-2 and the LC3B-II/I ratio, all of which were statis-

tically significant. (C-F) RT-qPCR and Western blotting confirmed that HDAC1 mRNA and total protein

levels were also significantly reduced in the W-treated group (G-I). An unpaired Student’s t-test was

used, with n=3 replicates, and significance levels indicated as * p<0.05, ** p<0.01, *** p<0.001,

**** p<0.0001. WA: Withaferin-A; HDAC1: histone deacetylase 1.

Table 2. IC50 of Withaferin-A in CRC Cells.

CRC Cells IC50 (WA=1uM)

CACO2

48h

PCMV-HDAC1

PCMV-NC

2.341

1.738

HT-29

48h

PCMV-HDAC1

PCMV-NC

3.239

2.507

CRC: colorectal cancer; WA: Withaferin-A. IC50: half-

maximal inhibitory concentration; CACO2: human

colon adenocarcinoma-derived cell line; HT-29 human

colorectal adenocarcinoma epithelial cell line; HDAC1:

Histone Deacetylase 1 enzyme; PCMV-HDAC1: CRC

cells transfected with HDAC1; PCMV-NC: CRC cells

not transfected with HDAC1.

Withaferin-A induces apoptosis and autophagy in colorectal cancer cells 85

Vol. 67(1): 73 - 91, 2026

diseases 19-21. WA, a steroidal lactone, is a

promising anticancer phytochemical that

is abundantly isolated from Withania som-

nifera (a medicinal plant native to Asia) and

exhibits anti-inflammatory, immunomodula-

tory, and anti-angiogenic properties22, 23. The

potency of natural drugs or potential toxic-

ity can often be addressed through semi-syn-

thetic approaches. WA exerts its anti-tumor-

igenic effects in different types of cancer,

especially in breast cancer 24.

Anticancer effect of WA contains its ef-

fects on cancer-relevant cellular processes

(e.g., growth arrest, apoptosis induction,

autophagy, metabolic adaptation, immune

function, etc.) and molecular targets (e.g.,

suppression of oncogenes such as estrogen

receptor-α, signal transducer and activator

of transcription 3, etc.) 25, 26. WA has promis-

ing roles in cancer prevention and therapy. It

can reduce cellular proliferation and viabil-

ity in certain cancer cell lines, modulate in-

flammatory pathways, and induce apoptosis,

all of which have piqued interest in its use as

a potential chemotherapeutic agent 27.

Some reported its ability to regulate

epigenetic processes. However, acetylation

has been studied infrequently, particularly

Fig. 4. The HDAC activity/Inhibition Assay showed that both WA and TSA decreased total HDAC mRNA levels,

with the difference being statistically significant (A). HDAC1 mRNA and protein levels were measured

by RT-qPCR and Western blotting, respectively, and the upregulation ratios indicated a statistically

significant difference (B-D). The results of the CCK8 assay are presented in (E and F). The number of

colonies for both groups, as shown in the graphs, was quantified and displayed in histograms (G and

H). The wound-healing assay and its statistical analysis are shown in (I and J). The number of cells

migrating into the lower chamber (K and L) differed significantly. An unpaired Student’s t-test was

used, with n≥3 replicates. Significance levels are indicated as * p<0.05, ** p<0.01, **** p<0.0001.

WA: Withaferin-A; HDAC1: histone deacetylase 1; TSA: Trichostatin A.

86 Wang and Li

Investigación Clínica 67(1): 2026

in CRC cells. Histone acetylation is cata-

lyzed by histone acetyltransferase (HAT) and

HDACs. The goal of this study was to exam-

ine the anticancer effects of WA in CRC cells

and to elucidate the mechanisms underlying

its regulation of acetylation.

Firstly, cell proliferation and motility/

migration in the WA group were significant-

ly reduced compared to the control group.

Secondly, WA induces apoptosis in CRC

cells, with a significant increase in the Bax/

Bcl-2 ratio at both the protein and mRNA

levels. Thirdly, WA induces autophagy in

CRC cells; p62 protein and mRNA expres-

sion were significantly decreased, while

LC3B-II/I levels were significantly increased.

Moreover, MDC staining and the TEC assay

confirmed autophagy induction. Fourthly,

the HDAC Activity Assay revealed that WA

can inhibit HDAC activity, similar to Tricho-

statin A (TSA), a specific HDAC inhibitor.

The differences were statistically significant.

In this study, WA also increased the LC3B-

II/I ratio and decreased p62 protein and

mRNA levels. The increase in LC3B-II could

be due to increased autophagosome forma-

tion or impaired degradation, whereas p62,

an autophagic substrate, shows a continuous

decrease, suggesting enhanced rather than

blocked autophagic flux. Activation of au-

tophagic flux was further confirmed by TEM

observation of numerous autophagosomes,

punctate MDC accumulation, and LC3B im-

munofluorescence. Because p62 also has sig-

nal-transduction functions, its degradation

can weaken pro-survival pathways, thereby

increasing WA cytotoxicity. Notably, HDAC1

overexpression reversed the decrease in p62,

suggesting that HDAC1 may “clamp” au-

tophagic flux by transcriptionally repressing

certain core autophagy genes or upregulat-

ing mTORC1 signaling; after WA relieves this

Fig. 5. The apoptosis rates between the two groups also differed significantly (A and B). RT-qPCR assay

verified that the mRNA levels (C and D) of LC3B, Bax, Bcl-2, and p62 (E and F) are statistically sig-

nificant. Western blotting confirmed the total protein expression of p62, LC3B-II/I, and Bax/Bcl-2

(G and H), with statistical significance (G and H). An unpaired Student’s t-test was used, with n=3

replicates. * p<0.05, ** p<0.01, *** p<0.001.

Withaferin-A induces apoptosis and autophagy in colorectal cancer cells 87

Vol. 67(1): 73 - 91, 2026

Fig. 6. Structure of IQ (A). Dose and timing of Oil/WA and IQ in different groups (B). Images of mice’s dy-

namic weight (C) and colorectal tissues (D). HE staining showed that the percentage of ACF varied

significantly across groups (E). Representative immunohistochemical images and quantitative analy-

ses of LC3B and p62 expression across groups (×200) were also statistically significant (F-test). n=5

mice per group; two-way repeated-measures ANOVA was used for (C), and one-way ANOVA followed

by Tukey’s post hoc test for (E) and (F). ** p<0.01, *** p<0.001, **** p<0.0001. IQ: 2-amino-

3-methyl-3H-imidazo[4,5-f]quinoline; WA: Withaferin-A.

Fig. 7. Mechanism diagram

WA: Withaferin-A, HDAC: Histone deacetylase, Ac: Acetylation, LC3: microtubule-associated protein

1 light chain 3, BCL-2: B cell lymphoma/leukemia-2 protein, Bax: Bcl-2-associated X protein, p62:

ubiquitin-binding protein p62.

88 Wang and Li

Investigación Clínica 67(1): 2026

“clamp,” autophagosome formation acceler-

ates along with degradation, leading to p62

consumption. An increased Bax/Bcl-2 ratio

is a classic mitochondrial apoptosis switch.

HDAC1 binds to the transcriptional repres-

sion complex Sin3A/CoREST to deacetylate

histone H3K9 at the Bax gene promoter

and inhibit transcription; simultaneously,

HDAC1 can deacetylate non-histone pro-

teins, thereby weakening their pro-apoptotic

functions 14. Following HDAC1 inhibition by

WA, acetylation levels at the Bax promoter

region are restored, and transcription is en-

hanced. Bcl-2 is then downregulated due to

the loss of HDAC1-mediated sustained STAT3

activation, leading to an increased Bax/Bcl-

2 ratio, greater mitochondrial outer mem-

brane permeability, cytochrome c release,

and activation of the caspase-9/3 cascade 22.

Overexpression of HDAC1 again increased

histone deacetylation levels and reversed

these effects, supporting the HDAC1-acetyl-

Bax/Bcl-2-mitochondrial apoptosis axis as a

key mechanism of WA.

As previously described, WA may func-

tion like a histone deacetylase inhibitor in

CRC cells. Therefore, we hypothesized that

WA promotes cancer cell death by inhibiting

the epigenetic effects of HDACs 15. Among

these, HDAC1 plays an important role. Sub-

sequent experiments confirmed this: HDAC1

expression was significantly upregulated af-

ter transfection with a lentiviral vector and

purine screening. HDAC1 mRNA and protein

levels were measured by RT-qPCR and West-

ern blotting, and the upregulation ratio dif-

fered significantly. The CCK8 assay revealed

that the IC50 values of the two groups also

differed significantly. Cell proliferation and

motility/migration in the PCMV-HDAC1

group were significantly higher than in the

NC group. The rates of apoptosis and autoph-

agy also differed significantly between the

two groups. RT-qPCR and Western blotting

verified that the mRNA and total protein ex-

pression levels of p62/LC3II/I and Bax/Bcl-2

were statistically significant. Based on these

results, we found that the anti-cancer effect

of WA against the PCMV-HDAC1 group was

significantly lower than against the PCMV-

NC group.

Finally, to validate our in vitro re-

sults, we also examined the effects of WA

in C57BL/6J mice. The IQ-induced inflam-

matory CRC model was characterized by

a spike in ACF numbers, increased LC3B

speckles, and cytoplasmic accumulation of

p62 as the main pathological features. Af-

ter WA treatment, the number of ACFs de-

creased by more than 60%, and p62/LC3B

levels in intestinal tissue decreased signifi-

cantly. It is important to note that the body

weight curve of WA-treated mice was similar

to that of the control group, indicating that

WA is safe at effective doses and provides a

solid basis for its potential future use as an

HDAC1-targeted CRC chemopreventive or

adjuvant therapy.

This novel treatment may offer a strat-

egy for CRC treatment. In addition to the

previously mentioned detection of HDAC1

expression, WA could also inhibit other

HDACs in CRC cells. Acetylation of histones

can serve as specific anchors for recruiting

transcription factors. Finding downstream

transcription factors may further elucidate

the anti-cancer mechanism of WA. A mecha-

nism diagram is shown in Fig. 7.

These results demonstrate that WA can

inhibit CRC cell proliferation and migration.

The treatments also decreased Bcl-2 expres-

sion and increased Bax expression, thereby

elevating the Bax/Bcl-2 ratio. Undeniably,

WA enhanced apoptosis in CRC cells. WA

also promotes autophagy in CRC cells. Fur-

thermore, we examined the molecular mech-

anisms underlying WA-induced apoptosis

and autophagy in CRC cells. When HDAC1

was overexpressed using a lentiviral vector,

all prior effects were abolished. We confirm

that these effects are mediated by HDAC1

downregulation. Finally, we tested whether

WA had similar effects in CRC cells in vitro.

It significantly affected p62 and LC3B levels

compared to the oil and IQ groups. The ani-

mal model yielded similar results.

Withaferin-A induces apoptosis and autophagy in colorectal cancer cells 89

Vol. 67(1): 73 - 91, 2026

Although this study offers initial evi-

dence for the anticancer effects of WA in

colorectal cancer and indicates that these

effects may be mediated through HDAC1-

dependent regulation of apoptosis and au-

tophagy, further research using more diverse

experimental models, detailed mechanistic

studies, and thorough safety assessments is

essential to advance its clinical application.

Only Caco-2 and HT-29 cell lines were used

in vitro, and their molecular characteristics

and drug responses may differ from those of

primary tumor cells or patient-derived organ-

oids (PDOs). Additionally, the mouse ACF

model only represents the early stage of car-

cinogenesis, and the effectiveness of WA on

established tumors has not been evaluated.

Therefore, it is crucial to further verify the

safety window, optimal dose, and pharmacoki-

netic properties of WA using primary cultures,

PDO/PDX models, and larger-animal studies,

providing a foundation for early clinical trials.

Future research should identify the specific

molecular targets of WA, explore combina-

tion therapies, and perform preclinical phar-

macokinetic evaluations to determine the

feasibility of WA as a candidate for colorectal

cancer prevention and treatment.

This study demonstrated, in both in vi-

tro and in vivo models, that WA decreases

HDAC1 expression while promoting apop-

tosis and autophagy in human colorectal

cancer cells. This process inhibits cell pro-

liferation, migration, and colony formation,

and significantly reduces IQ-induced ACF

in mice. These findings support further de-

velopment of WA as a chemopreventive or

adjunct therapy for colorectal cancer. Since

WA did not cause weight loss or overt toxic-

ity in mice at effective doses, and its molecu-

lar target, HDAC1, is often overexpressed in

patients with colorectal cancer, WA seems to

be a promising, low-toxicity, epigenetically

targeted oral drug candidate.

Funding

This work received no funding support.

Ethical approval

This study was conducted following the

principles of the Declaration of Helsinki.

Approval was received from the Laboratory

Animal Ethical and Welfare Committee of

Shandong University Qilu College of Medi-

cine (Approval number: 21099).

Consent to participate

Informed consent was secured from all

participants involved in the study.

Competing interests

The authors have no relevant financial

or non-financial interests to disclose.

ORCID numbers of authors

• Qiong Wang (QW):

0000-0003-1561-7559

• Caixia Li (CL):

0009-0003-4741-0429

Author contributions

Both authors contributed to the study’s

conception and design, participated in data

collection, and reviewed and edited the man-

uscript. Both authors read and approved the

final version.

REFERENCES

1. Puspitaningtyas H, Wiranata JA, Wi-

ratama BS, Fachiroh J, Hutajulu SH.

Association of Low Educational Attain-

ment and Higher Colorectal Cancer Risk:

Mediatory Effect of Lifestyle-Associated

Factors Within Local Context. World J

Oncol. 2025; 16(4):388-396. https://doi.

org/10.14740/wjon2599.

2. Huang P, Guo K, Tu J, Fang J, Zhou L,

Luo X, et al. Single-Cell RNA Sequencing

Reveals LEF1 as a Prognostic Biomarker

for Poor Outcomes in Oxaliplatin-Resis-

tant Colorectal Cancer. Hum Mutat. 2025;

2025:6705599. https://doi.org/10.1155/

humu/6705599.

90 Wang and Li

Investigación Clínica 67(1): 2026

3. Shen R, Cheng F, Guo R, Wang W, Yang X,

Chen Y, et al. Dehydroleucodine exerts an

antiproliferative effect on human Burkitt’s

lymphoma Daudi cells via SLC7A11-media-

ted ferroptosis. Front Pharmacol. 2025;

16:1572364. https://doi.org/10.3389/

fphar.2025.1572364.

4. Wu HC, Tsai CC, Hsu PC, Kuo CY. Her-

bal Medicine in Breast Cancer Therapy:

Mechanisms, Evidence, and Future Pers-

pectives. Curr Issues Mol Biol. 2025;

47(5):362. https://doi.org/10.3390/cim

b47050362.

5. Lee J, Seo Y, Roh JL. Emerging Therapeu-

tic Strategies Targeting GPX4-Mediated

Ferroptosis in Head and Neck Cancer. Int

J Mol Sci. 2025; 26(13):6452. https://doi.

org/10.3390/ijms26136452.

6. Chen X, Ma X, Hu X, Wang C, Zhang X,

Yan C. Mechanisms and potential thera-

peutic strategies of withaferin A in breast

cancer. Pharmacol Rep. 2025; 77: 1163-

1176. https://doi.org/10.1007/s43440-

025-00736-3.

7. Heyninck K, Lahtela-Kakkonen M, Van der

Veken P, Haegeman G, Vanden Berghe W.

Withaferin A inhibits NF-kappaB activation

by targeting cysteine 179 in IKKβ. Biochem

Pharmacol. 2014; 91(4):501-509. https://

doi.org/10.1016/j.bcp.2014.08.004.

8. Choi BY, Kim BW. Withaferin-A Inhibits

Colon Cancer Cell Growth by Blocking

STAT3 Transcriptional Activity. J Cancer

Prev. 2015; 20(3):185-192. https://doi.

org/10.15430/JCP.2015.20.3.185.

9. Yan Z, Guo R, Gan L, Lau WB, Cao X,

Zhao J, et al. Withaferin A inhibits apop-

tosis via activated Akt-mediated inhibi-

tion of oxidative stress. Life Sci. 2018;

211:91-101. https://doi.org/10.1016/j.

lfs.2018.09.020.

10. Mirza S, Sharma G, Parshad R, Gupta

SD, Pandya P, Ralhan R. Expression of

DNA methyltransferases in breast can-

cer patients and to analyze the effect of

natural compounds on DNA methyltrans-

ferases and associated proteins. J Breast

Cancer. 2013;16(1):23-31. https://doi.

org/10.4048/jbc.2013.16.1.23.

11. Duan N, Hu X, Qiu H, Zhou R, Li Y, Lu W,

et al. Targeting the E2F1/Rb/HDAC1 axis

with the small molecule HR488B effecti-

vely inhibits colorectal cancer growth. Cell

Death Dis. 2023; 14(12):801. https://doi.

org/10.1038/s41419-023-06205-0.

12. Yang Z, Su W, Zhang Q, Niu L, Feng B,

Zhang Y, et al. Lactylation of HDAC1

Confers Resistance to Ferroptosis in

Colorectal Cancer. Adv Sci (Weinh).

2025; 12(12):e2408845. https://doi.

org/10.1002/advs.202408845.

13. Likasitwatanakul P, Li Z, Doan P, Spisak

S, Raghawan AK, Liu Q, et al. Chemical

Perturbations Impacting Histone Acetyla-

tion Govern Colorectal Cancer Differentia-

tion. Gastroenterology. 2026; 170(1):70-

88. S0016-5085(25)05732-4. https://doi.

org/10.1053/j.gastro.2025.07.003.

14. Dhingra N, Gupta V, Tyagi A, Agrawala

PK, Gupta V. Trichostatin A ameliorated

combined radiation and skin wound injury-

induced mortality and hematopoietic sup-

pression in a rat model. Int J Radiat Biol.

2025; 101(9):952-972. https://doi.org/10

.1080/09553002.2025.2537211.

15. Al-Rimawi F, Rishmawi S, Ariqat SH, Kha-

lid MF, Warad I, Salah Z. Anticancer Acti-

vity, Antioxidant Activity, and Phenolic and

Flavonoids Content of Wild Tragopogon po-

rrifolius Plant Extracts. Evid Based Comple-

ment Alternat Med. 2016; 2016:9612490.

https://doi.org/10.1155/2016/9612490.

16. Yang R, Sun S, Zhang Q, Liu H, Wang L,

Meng Y, et al. Pharmacological Inhibition

of TXNRD1 by a Small Molecule Flavonoid

Butein Overcomes Cisplatin Resistance in

Lung Cancer Cells. Biol Trace Elem Res.

2025; 203(4):1949-1960. https://doi.

org/10.1007/s12011-024-04331-0.

17. Liu P, Zhang B, Li Y, Yuan Q. Potential

mechanisms of cancer prevention and

treatment by sulforaphane, a natural small

molecule compound of plant-derived.

Mol Med. 2024; 30(1):94. https://doi.

org/10.1186/s10020-024-00842-7.

18. An T, Yin H, Lu Y, Liu F. The Emerging

Potential of Parthenolide Nanoformula-

tions in Tumor Therapy. Drug Des Devel

Withaferin-A induces apoptosis and autophagy in colorectal cancer cells 91

Vol. 67(1): 73 - 91, 2026

Ther. 2022; 16:1255-1272. https://doi.

org/10.2147/DDDT.S355059.

19. Vidjeyamannane C, Joy A, Prakash K, Sa-

ravanakumar R. A comprehensive review

on the role of plant-derived bioactive me-

tabolites driving ROS-mediated apoptosis

in cancer. Med Oncol. 2025; 42(9):420.

https://doi.org/10.1007/s12032-025-

02985-x.

20. Wang H, Gu B, Wang Z, Zhang X, Shan

L, Liu L, et al. Emodin enhances host an-

tiviral immunity against Micropterus sal-

moides rhabdovirus by activating RLR sig-

naling in largemouth bass. Fish Shellfish

Immunol. 2025; 166:110633. https://doi.

org/10.1016/j.fsi.2025.110633.

21. Dzięgielewska M, Tomczyk M, Wiater A,

Woytoń A, Junka A. Targeting Ocular Bio-

films with Plant-Derived Antimicrobials

in the Era of Antibiotic Resistance. Mo-

lecules. 2025; 30(13):2863. https://doi.

org/10.3390/molecules30132863.

22. Lee K, Lee D, Kim JY, Shim JJ, Bae JW,

Lee JH. Attenuation Effect of Withania

somnifera Extract on Restraint Stress-

Induced Anxiety-like Behavior and Hip-

pocampal Alterations in Mice. Int J Mol

Sci. 2025; 26(15):7317. https://doi.org/

10.3390/ijms26157317.

23. Albalawi AA. Dual impact of Ashwagand-

ha: Significant cortisol reduction but no

effects on perceived stress - A systematic

review and meta-analysis. Nutr Health.

2025; 31(4):1395-1408. https://doi.org/

10.1 177/02601060251363647.

24. Elzayat EM, Elsamahy GE, Mansour GH,

El-Sherif AA, Hassan N. The Synergistic

and Anticancer Potential of Withania Som-

nifera (Ashwagandha) Ethanol Extract as

an Adjuvant with Doxorubicin in MCF7

Breast Cancer Cell Line. Asian Pac J Can-

cer Prev. 2025; 26(3):757-766. https://

doi.org/10.31557/APJCP.2025.26.3.757.

25. Baghel K, Azam Z, Srivastava R. Dietary

restriction-induced alterations on estro-

gen receptor alpha expression in regu-

lating fertility in male Coturnix coturnix

japonica: Relevance of Withania somnifera

in modulation of inflammation and oxida-

tive stress in testis. Am J Reprod Immu-

nol. 2024; 91(2): e13816. https://doi.

org/10.1111/aji.13816.

26. White PT, Subramanian C, Motiwala HF,

Cohen MS. Natural Withanolides in the

Treatment of Chronic Diseases. Adv Exp

Med Biol. 2016; 928:329-373. https://doi.

org/10.1007/978-3-319-41334-1_14.

27. Hameed H, Afzal M, Khan MA, Javaid L,

Shahzad M, Abrar K. Unraveling the role

of withanolides as key modulators in breast

cancer mitigation. Mol Biol Rep. 2025;

52(1):331. https://doi.org/10.1007/s110

33-025-10442-1.